Thesis for the Degree of Master of Science ******************
Expression of Avian Influenza Virus (H9N2) Genes and Its Diagnostic Application
LE VAN PHAN
Department of Veterinary Medicine, Graduate School, Chungbuk National University, South Korea
Supervised by Professor: Kang, Shien-Young
February, 2006
TABLE OF CONTENTS Contents……………………………………………………………………..i SUMMARY.....................................................................................................1 I.
GENERAL INTRODUCTION…………………..………....……3
II.
LITERATURE REVIEW…………………………….…………..5
1.
History and pandemics……………………..……….….……….5
2.
Influenza virus structure and its properties………….…...7
2.1.
Structure of influenza viruses…………………….……..……7
2.2.
Types, subtypes, and strains of influenza virus...............10
2.3.
Morphology and propagation of influenza virus………....11
3.
Evolution and ecology of influenza viruses……..……….12
3.1.
Species and subtype variation……………….……………...12
3.2.
Antigenic shift & drift………………………………………...14
3.3.
Replication cycle of influenza viruses…………...………..15
3.4.
Interspecies transmission…………….………..……………17
3.5.
Avian influenza outbreaks in poultry………….………......19
III.
MATERIALS AND METHODS…………………….…….......22
1.
Cloning and expression of NP, HA, NA and NS1 gene...22
1.1.
Viruses and RNA extraction………….………………….......22
1.2.
Primer design…………………………….....………………..….22
i
1.3.
Reverse transcription and polymerase chain reaction (RT-PCR)…………………….………………………………… 23
1.4.
Cloning of the NP, HA, NA and NS1 gene………………..23
1.5.
Expression of the NP, HA, NA and NS1 gene…………...24
1.6.
Confirmation of recombinant baculoviruses………………25
2.
Production of monoclonal antibodies against NP, HA, NA and NS1 protein……………………………......................29
3.
Serodiagnosis of AIV…………..………….....………………..31
3.1.
Indirect ELISA for detection of antibodies to NP (i-ELISA/NP)…………………….......................……………….31
3.2.
Indirect capture ELISA for differentiation of naturally infected chickens from vaccinated ones (i-capture ELISA/NS)…………………………………..……36
IV.
RESULTS……………………………………..……...………..…41
1.
Expression of NP, HA, NA and NS1 gene……………....41
2.
Production of monoclonal antibodies against NP, HA, NA and NS1 protein…………………………………….….….47
3.
Serodiagnosis of AIV…….…...………………..…...….…….49
3.1.
Indirect ELISA for detection of antibodies to NP (i-ELISA/NP)…………………….......................……………….49
ii
3.2.
Indirect capture ELISA for differentiation of naturally infected chickens from vaccinated ones (i-capture ELISA/NS)……………………………………….58
V.
DISCUSSION………………………………..……...……………62
VI.
CONCLUSIONS………………………………………….………68
REFERENCES.........................................................................................69 ACKNOWLEDGMENTS..........................................................................77
iii
Thesis for the Degree of Master of Science
Expression of Avian Influenza Virus (H9N2) Genes and Its Diagnostic Application
LE VAN PHAN
Department of Veterinary Medicine, Graduate School, Chungbuk National University, Korea
Supervised by Professor: Kang, Shien-Young
SUMMARY Vaccination campaigns for the control of avian influenza virus (AIV) in poultry population have been considered in some countries. In Korea, vaccination programs for the control of AIV (H9N2) in layers now are considered. However, the use of vaccines in such emergencies
still
has
limitations 1
due
to
the
problem
of
sero-differentiation
of
the
naturally
infected
chickens
from
vaccinated ones as well as the performing of quick diagnosis of AIV (H9N2). Therefore, the development and application of reliable, sensitive methods for quickly sero-diagnosis of AIV (H9N2) are of critical importance and necessary. In this study, the nucleocapsid (NP), hemagglutinin (HA), neuraminidase (NA) and nonstructural (NS1) gene of AIV (H9N2) were cloned and expressed successfully in baculovirus expression system. The indirect and capture enzyme linked immunosorbent assay (ELISA) for detection of antibodies specific for NP and NS1 protein of AIV (H9N2), respectively, have been set up successfully using recombinant proteins. The indirect ELISA (i-ELISA/NP) using NP recombinant protein as a specific antigen could clearly sero-diagnose the infected and non-infected chickens with AIV (H9N2) at the serum dilution of 1:500. The i-ELISA/NP has no cross- reactivity with known positive sera for IBDV and NDV. In comparison of the sensitivity of i-ELISA/NP with the IDEXX FlockChek kit test, the i-ELISA/NP was more sensitive than the IDEXX FlockChek kit test. For indirect capture ELISA using expressed NS1 protein (i-capture ELISA/NS), there were somewhat different results between reference and field sera. Even though i-capture ELISA/NS could clearly differentiate the naturally infected chickens from vaccinated ones using reference sera at the serum dilution of 1:200, it was not clear when using field sera.
2
I.
GENERAL INTRODUCTION Worldwide influenza pandemics have occurred at irregular and
unpredictable times throughout history and it is confidently expected that they will continue to occur in the future. Influenza is now globally important contagion. Natural infection with influenza A viruses have been reported in a variety of animal species including humans, pigs, horses, sea mammals, mustelids, and birds (8). Surveillances of live poultry markets in Hong Kong in 1997 revealed that H9N2 influenza viruses were the second most commonly isolated viruses, making up 4% of infected poultry, mainly in chickens (15, 52). By 1997, the H9N2 avian influenza virus had been isolated from Northern China, Korea, Pakistan, India, Saudi Arabia, Germany, Italy, Ireland, and South Africa (1, 15, 17, 38). In April 1999, two World Health Organization reference laboratories independently confirmed the isolation of avian influenza A (H9N2) viruses for the first time in human and these viruses were the cause of illness of two children who had been hospitalized in Hong Kong. Additional human illnesses attributed to influenza A (H9N2) occurred in Guangdong Province, Southern of China (41). Molecular characterization and phylogenetic analysis of Asian H9N2 isolates revealed multiple lineages. One lineage represented in the poultry contains six internal genes that are closely related to those of highly pathogenic H5N1 viruses in Hong Kong (16, 18). These findings suggest that the H9N2 influenza viruses from Asia are genetically heterogeneous and broadly distributed among the poultry
3
in the region and are raising a possibility that the H9N2 virus would be a potential source of further human infections, possibly, a new pandemic strain (18). In South Korea, vaccination programs for the control of AIV (H9N2) in layers are now considered. However, the use of vaccines in such emergencies still has limitations due to the problem of differentiation serologically of naturally infected from vaccinated chickens as well as the performing of quick diagnosis of AIV (H9N2). Therefore, the development of reliable and sensitive methods that could both quickly diagnose and differentiate the naturally infected sera from vaccinated sera of poultry population to AIV (H9N2) are of critical importance and necessary. In this study, the nucleocapsid, hemagglutinin, neuraminidase and nonstructural gene of Korean H9N2 avian influenza virus were cloned and expressed in baculovirus system. The expressed proteins were then characterized and employed as specific antigens in serological diagnosis of AIV (H9N2).
4
II.
LITERATURE REVIEW
1.
History and pandemics Influenza infections have been recognized in humans since
ancient times. The name influenza refers to the ancient belief that it was caused by a malign and supernatural influence (Latin influentia). The first recorded European pandemic was 1173-1174 although the first generally accepted pandemic occurred between 1510 and 1580. Since then there have been 31 documented pandemics although it is impossible to clearly identify the early history of flu with any certainty. The disease occurred frequently at irregular intervals and occasionally disappeared for periods of time, epidemics varied in severity usually causing mortality in the elderly. And some epidemics, particularly those that occurred in 1781 and 1830 appeared to spread across Russia from Asia (14). The “fowl plague”, now known to be caused by highly pathogenic avian influenza viruses, was first described in 1878 as a disease affecting chickens in Italy. The causative agent was eventually isolated from a chicken in 1902 [A/Chicken/Brescia/1902 (H7N7)], marking the first documented isolation of influenza virus. Similar outbreaks were observed in Europe and then worldwide, with subsequent isolation of several fowl plague viruses (H7 subtypes). By contrast, the first human influenza virus was not isolated until 1933 (24). During the 20th century, the emergence of new influenza A virus subtypes caused three pandemics, all of which spread around the world within 1 year of being detected. The first, "Spanish flu", 5
1918-1919, [A (H1N1)], caused the highest number of known influenza deaths: more than 500,000 people died in the United States, and up to 50 million people may have died worldwide. Many people died within the first few days after infection, and others died of complications later. Nearly half of those who died were young and healthy adults. Influenza A (H1N1) viruses still circulate today after being introduced again into the human population in the 1970s. The second, "Asian flu", 1957-1958, [A (H2N2)], caused about 70,000 deaths in the United States, first identified in China in late February 1957. The Asian flu spread to the United States by June 1957. The disease occurred in many countries and the total death rate probably exceeded 1 million people worldwide. The third, "Hong Kong flu",
1968-1969, [A (H3N2)], caused about 34,000 deaths in the United States. This virus was first detected in Hong Kong in early 1968 and spread to the United States later that year. Influenza A (H3N2) viruses still circulate today. The total deaths probably were about 500,000 people worldwide. Both the 1957-1958 and 1968-1969 pandemics were caused by viruses containing a combination of genes from a human and an avian influenza virus. The origin of the 1918-1919 pandemic virus is not clear. Recently, outbreaks of a highly pathogenic avian influenza A (H5N1) occurred in Hong Kong in 1997 and caused 6 people died among 18 hospitalized people. This was the first evident case of avian to human transmission. Outbreaks of a highly pathogenic avian influenza A (H5N1) occurred among poultry in 8 countries in Asia (Cambodia, China, Indonesia, Japan, Laos, South 6
Korea, Thailand and Vietnam) during late 2003 and early 2004. At that time, more than 100 million birds either died from the disease or were culled. From December 30, 2003 to March 17, 2004, 12 confirmed human cases of avian influenza A (H5N1) were reported in Thailand and 23 in Vietnam, resulting in a total of 23 deaths. Of particular note is one isolated instance of probable limited human-to-human transmission occurring in Thailand in September 2004. As of August 5, 2005, there have been 112 human cases of avian influenza A (H5N1) infections including 90 cases in Vietnam, 17 cases in Thailand, 4 cases in Cambodia, and 1 case in Indonesia, resulting in 57 deaths reported since January 2004 (26).
2.
Influenza virus structure and its properties
2.1.
Structure of influenza viruses Influenza viruses are enveloped viruses that contain single
stranded, negative-sense RNA with a
segmented genome (Table 1).
They belong to the family Orthomyxoviridae,
which includes
four
genera, the influenza A, B, C viruses and Thogotavirus. Eight RNA segments of influenza A and B viruses and 7 segments of influenza C viruses are independently encapsidated by the viral nucleoprotein (NP) and each segment is associated with a polymerase complex composed of the PA, PB1 and PB2. The polymerase complex binds to the 3’ and 5’ ends of the vRNA and holds the ends together in a circular structure (14). The subviral particle consisting of the viral RNA,
NP
and
polymerase
complex
is
referred
to
as
the
ribonucleoprotein (RNP) particle. The NP protein is the major 7
structural protein that interacts with the RNA segments to form the RNP. The NP binds to PB1, M1 and PB2 directly (46). The eight (or seven) RNP particles are located inside a shell of M1 protein that lines the viral lipid membrane. The lipid membrane is derived from the plasma membrane of the infected host cell. It becomes part of the viral particle during the budding process. Embedded in the viral membrane
are
hemagglutinin
three (HA)
proteins; and
the
two
spike
glycoproteins,
neuraminidase
(NA),
and
the a
membrane-channel protein, M2 (65). In order to render the virus particle to be infectious, the HA must be cleaved at the specific site into two subunits, HA1 and HA2, by a host-derived trypsin-like enzyme. The HA contains the receptor binding activity at the tip of molecule and the membrane fusion activity which is activated by the low pH in the endosome during entry into the cell. The NA contains the receptor destroying activity needed for release of the newly formed virus from the surface of the infected cell (11). M2 forms a membrane channel allowing acidification of the virus interior while it passes through the endosome after attachment and entry. This acidification is believed to be necessary for the release of RNP into the cytoplasm for viral replication and host cell infection (44, 58). The two nonstructural proteins, NS1 and NS2 are found in the infected cell while NS2 is also located in the virion.
8
Table 1. Genome of influenza virus and its function Segment
Size(nt)
Polypeptide(s)
Function
1
2341
PB2
Transcriptase: cap binding
2
2341
PB1
Transcriptase: elongation
3
2233
PA
Transcriptase: protease activity (?)
4
1778
HA
Hemagglutinin Nucleoprotein: RNA binding; part of
5
1565
NP
transcriptase complex; nuclear/ cytoplasmic transport of vRNA
6
1413
NA
Neuraminidase: release of virus Matrix protein: major component of
M1 7
virion
1027 Integral membrane protein - ion
M2
channel Non-structural: nucleus; effects on cellular RNA transport, splicing,
NS1
translation. Anti-interferon protein. 8
890 Non-structural: nucleus, cytoplasm,
NS2
function unknown
9
2.2.
Types, subtypes, and strains of influenza virus There are three types of influenza viruses: A, B, and C which
can be differentiated on the basis of the antigenicity of their internal antigens including nuclear and matrix proteins. Influenza A virus is considered to be the best characterized and the most serious threat to public health because it causes very large epidemics with significant mortality in both birds and mammals including humans. Influenza A therefore been the most intensively studied and has been the focus of efforts to prevent and control influenza outbreaks (12, 13, 31, 45). Influenza type A viruses are subtyped further on the basis of antigenic differences on the external glycoproteins, the HA and NA proteins. Sixteen different HA subtypes (H1-H16) and nine different NA subtypes (N1-N9) have been identified (26). Subtypes of influenza A virus are named according to their HA and NA surface proteins. The HA and NA spikes occur in a ratio of about 8:1 and the HA glycoprotein constitutes about 40% of the total mass of the virus particle. Many different combinations of HA and NA proteins are possible. There are theoretically 16 x 9 = 144 combinations of HA and NA. Only some influenza A subtypes (H1N1, H1N2 and H3N2) are currently in general circulation among people. Other subtypes are found most commonly in other animal species. Influenza B viruses are normally found only in humans. Unlike influenza A viruses, these viruses are not classified according to subtype. Although influenza type B viruses can cause human epidemics, they did not cause pandemics. Influenza type C viruses cause mild illness in humans and do not cause epidemics or pandemics. These viruses are not 10
classified according to subtype. Influenza B viruses and subtypes of influenza A virus are further characterized into strains. There are many different strains of influenza B viruses and influenza A subtypes. New strains of influenza viruses appear and replace older strains. This process occurs through a type of change called antigenic drift. When a new strain of human influenza virus emerges, antibody protection that may have developed after infection or vaccination with an older strain may not provide protection against the new strain. Thus, the influenza vaccine is updated on a yearly basis to keep up with the changes in influenza viruses (26). 2.3.
Morphology and propagation of influenza virus Influenza A particles are highly pleomorphic, ranging from
small spherical particles 80–120 nm in diameter to long filamentous particles up to several micrometres in length. The morphological characteristics of influenza viruses are a genetic trait but spherical morphology depends on passage in eggs or tissue culture (4, 29). Fresh clinical isolates of influenza viruses are characterized by the presence of a significant proportion of filamentous virions in virus preparations. However, after multiple passages in eggs or tissue culture, virus preparations often consist mainly of virions with spherical morphology. The filamentous morphology of influenza A virus is genetically determined, as shown by virus gene reassortment experiments (4). The influenza viruses are relatively unstable in the environment. Heat, extreme changes of pH, or nonisotonic conditions and dryness can readily inactivate the influenza viruses.
11
Influenza viruses can be grown in embryonated chicken eggs or in primary tissue culture systems. Egg inoculation is still used today and is the system of choice for vaccine production and the acquisition of a large volume of virus stock used for laboratory studies. Isolation of human viruses through tissue culture systems from either primary monkey kidney or Mandin Darby canine kidney (MDCK) cells is well established. Most human and avian influenza viruses can be grown in eggs and detected through the agglutination of erythrocytes. The surface glycoproteins of the virus bind sialic acid receptors on erythrocytes causing the agglutination. Influenza viruses will replicate, cause cytopathology and produce plaques in many primary tissue cultures. However few cell systems other than primary kidney cells are suitable for plaque formation unless trypsin is added to cleave the HA to activate the virus (14).
3.
Evolution and ecology of influenza viruses
3.1.
Species and subtype variation Influenza A viruses are found in many different animals,
including ducks, chickens, pigs, whales, horses and seals. However, certain subtypes of influenza A virus are specific to certain species, except for birds which are hosts to all subtypes of influenza A. Subtypes that have caused widespread illness in people either in the past or the current period are H3N2, H2N2 and H1N1 subtypes. Influenza B viruses are restricted to humans while type C viruses have been isolated from humans and pigs. The clinical symptoms associated
with
influenza
infections 12
in
avian
species
range
considerably with each strain of the virus. The strains, which cause the pathogenic infection in the birds, are of the H5 and H7 subtypes and are referred to as highly pathogenic avian influenza (HPAI) strains. Influenza A viruses normally seen in one species sometimes can cross over and cause illness in another species. The segmented genome allows viruses from different species to mix and create a new influenza A virus if viruses from two different species infect the same person or animal. The resulting new virus might then be able to infect humans and spread from person to person, but it would have surface proteins (hemagglutinin and/or neuraminidase) not previously seen in influenza viruses that infect humans. The mechanism for the creation of a new combination of the eight RNA segments of two different influenza viruses is called genetic reassortment. In cells co-infected with two influenza A viruses with different genetic constitutions, there is an exchange of homologous segments which may result in the emergence
of
stable
reassortments.
Some
of
the
28=256
mathematically possible combinations of genes might not allow the formation of an infectious virus capable of replicating in the host organism or being efficiently transmissable in the animal or human host population (13). The direct transmission of avian H5N1 and H9N2 viruses to humans in southeastern China and Hong Kong in 1997, 1999 and 2004-2005 have renewed interest in the role of avian influenza virus zoonosis (15, 42, 43). These infections raise the possibility that a pandemic influenza virus could arise from the direct transmission of an avian influenza virus to humans. The one barrier holding the 13
current H5N1 from causing real trouble in Asia and worldwide is the lack of successful human-to-human transmission. If these avian viruses are able to infect humans and establish an infection there is always a chance for reassortment between this avian virus and a co-circulating human influenza virus, thus creating a new virus that can easily transmit to humans. Therefore, avian influenza viruses are important not only because they cause economic losses in poultry but also because they can cause influenza outbreaks in humans and other mammals by either directly transmitting to or by contributing viral genes to viruses in these species. 3.2.
Antigenic shift & drift Influenza is a very difficult disease to prevent and control
because it can change in two different ways: antigenic shift and drift. Antigenic drift is the process by which mutations accumulate in the virus genome, usually because of immune selection, that results in development of new strains of the virus. The new strains are partially resistant to the immunity induced by infection with previous strains of virus. After several years of drift, the strain may be sufficiently distinct to cause disease in a person previously infected, but the illness is usually less severe because of partial immunity to the new strain. This is one of the main reasons why people can get the flu more than one time. In most years, one or two of the three virus strains in the influenza vaccine are updated to keep up with the changes in the circulating flu viruses. For this reason, people who want to be immunized against influenza need to receive a flu
14
vaccination every year. Antigenic shift is an abrupt major change in the influenza A viruses through viral reassortment resulting in a new influenza
virus
with
a
hemagglutinin
or
hemagglutinin
and
neuraminidase combination that has not been seen for many years. Reassortment occurs in one cell, in a susceptible host with two different strains, either two avian or an avian and human. This new reassortant strain is unrelated to any previous strain circulating and may cause the biggest problems. Such a new suptype often causes the pandemics in the human population in which a significant fraction of people become infected, because there is no or a little immunity to the virus carrying these new surface antigens in a large fraction of the population. Antigenic and genetic studies strongly suggested that the 1957 Asian (suptype H2N2) and 1968 Hong Kong (suptype H3N2) pandemic strains were generated by genetic reassortment between human and avian viruses. Influenza viruses are changing by antigenic drift all the time, but antigenic shift happens only occasionally. Influenza type A viruses undergo both kinds of changes but influenza type B viruses change only by the more gradual process of antigenic drift (26). 3.3.
Replication cycle of influenza viruses Influenza virus attachment to the susceptible cell is mediated
by the interaction between the viral hemagglutinin and sialic acid receptors present on glycolipids and glycoproteins on the cell surface (30). The receptor specificity of influenza virus varies according to the host animal from which the virus was isolated. In humans,
15
influenza viruses preferentially recognize sialyloligosaccharides terminated by N-acetylsialic acid linked to galactose by the ɑ-2,6 linkage (NeuAcɑ2,6Gal), whereas avian and equine viruses recognize
N-acetylsialic acid linked to galactose by the ɑ-2,3 linkage (NeuAcɑ2,3Gal). The epithelial cells in the human trachea contain mainly NeuAcɑ2,6Gal whereas those in the horse trachea and duck intestine
(where
avian
viruses
replicate)
contain
mainly
NeuAca2,3Gal linkages. Interestingly, the epithelial cells in the pig trachea contain both NeuAca2,6Gal and NeuAca2,3Gal linkages (24). After binding to sialic acid-containing receptors on the membrane surface, the virus enters the cell by receptor-mediated endocytosis. A low pH in the endosome induces a conformational change in HA resulting in membrane fusion between the viral envelope and the endosomal membrane. Within the endosome, the M2 proton channel exposes the viral core to low pH resulting in dissociation of M1 from RNP and leading to a release of RNP to the cytoplasm. RNP is then transported to the nucleus most probably by nuclear localization signals in proteins composed of the RNP complex (PB1, PB2, and NP). The mechanism of viral RNA transcription is unique. The 5’ cap from cellular mRNAs is cleaved by a viral endonuclease and used as a primer for transcription by the viral transcriptase. Six of eight RNA segments are transcribed into mRNAs in a monocistronic manner and translated into HA, NA, NP, PB1, PB2, and PA. By contrast, two RNA segments are each transcribed to two mRNAs by splicing. For both the M and NS genes, these mRNAs are translated in different reading frames, generating 16
M1 and M2 proteins and NS1 and NS2 proteins, respectively. It is believed that the increased concentration of free NP triggers the shift from mRNA synthesis to cRNA and vRNA synthesis. Newly synthesized vRNAs are encapsidated with NP in the nucleus, where they function as templates for secondary transcription of viral mRNAs. Later in infection, the principal translation products are M1, HA and NA. HA and NA are glycosylated in the rough endoplasmic reticulum, further processed in the Golgi apparatus and then transported to the cell surface, where they integrate into the cell membrane. Nuclear localization of M1 and NS2 proteins is essential for the migration of RNP out of the nucleus for assembly into progeny viral particles in the cytoplasm. The RNP-M1 complex presumably interacts with M1 proteins that are associated with the plasma membrane and then buds outward through the cell membrane, enclosing itself within a bubble of membrane (envelope) studded with both the HA and NA glycoproteins (24). The activity of the neuraminidase
becomes
again
important
by
disrupting
viral
aggregates and thus releasing viral particles that can start a new cycle of infection. 3.4.
Interspecies transmission Influenza A viruses easily often cross species barriers. For the
introduction of a foreign gene into a new genetic constellation by reassortment, an adaptation must take place. This adaptation must occur for optimal function of the new gene within the framework of the available viral proteins. Although aquatic birds are the natural
17
reservoir for influenza A viruses, the viruses from these birds replicate poorly in mammals including humans (19, 22, 61). Therefore, viruses from aquatic species must undergo some change before they can cross the species barrier. Influenza viruses can reassort because of their segmented genome. Human influenza strains are thought to be able to acquire genes from avian influenza viruses through this reassortment or through an adaptation in an intermediate (50). Swine may be the mixing vessel for the reassortment of human and avian influenza viruses. Pigs have receptors in both the NeuAcɑ2,3Gal and NeuAcɑ2,6Gal conformation and are susceptible to influenza viruses from both avian and human sources (28). Therefore the pig can reassort an avian and human virus producing a new virus to which the human population is immune naive. In areas of Asia where backyard pigs co-mingle with chickens and even migratory ducks, the potential for reassortment is present. The infrequent transmission of avian influenza viruses to pigs may be the limiting factor in their role as intermediate hosts. Studies have shown evidence that H3N2 human influenza virus variants can persist in pigs after leaving the human population. However, in nature, a limited number of human and avian viruses have established stable lineages in swine. An only occasional transmission of influenza from pigs to humans resulting in respiratory disease has been noted (6, 7, 35, 53). In 1997 in Hong Kong, H5N1 viruses circulating in poultry were transmitted to humans, which caused 18 illnesses and led to 6 deaths (52). Genetic characterization of the isolates from humans and 18
poultry in Hong Kong live bird markets indicated that avian H9N2 and H6N1 viruses were co-circulating with the avian H5N1 virus. Both the H6N1 and H9N2 viruses are endemic in quail in Hong Kong. The H9N2 virus was first isolated in quail in 1988 and transmitted to humans and swine by 1999 (9, 15, 16, 23, 42). In particular, A/Quail/HK/G1/97 (H9N2) is thought to have been involved in the generation of the highly pathogenic H5N1 human virus of 1997. The six internal genes of this quail H9N2 as well as the human cases of H9N2 infections were similar to the internal genes of the H5N1 viruses co-circulating in poultry in 1997. The H5N1 viruses were reassortants
that
derived
their
internal
genes
from
a
Qa/HK/G1/97-like virus (33, 35). The antigenic differences between human and swine H9N2 isolates show that swine viruses were not intermediates in avian to human transmission indicating land-based poultry are a potential source of influenza viruses that can transmit to humans (35, 54, 61). Phylogenetic analysis of the H9N2 influenza viruses isolated in domestic ducks in southern China during the 2000-2001 season indicate that the H9N2 virus lineage has transmitted back to the ducks creating double and sometimes triple reassortants with viruses resident in the ducks (32). This creates a two-way
transmission
between
terrestrial
and
aquatic
birds
generating multiple genotypes of H9N2 viruses containing internal genes of aquatic avian origin and more importantly creating a virus with pandemic potential. The human outbreak of H5N1 in Hong Kong in 1997 and present situation was clearly proof that avian viruses can transmit directly to humans (14).
19
3.5.
Avian influenza outbreaks in poultry Avian influenza viruses circulate among birds worldwide.
Certain birds, particularly water birds, act as hosts for influenza viruses by carrying the virus in their intestines and shedding it. Infected birds shed virus in saliva, nasal secretions and feces. Susceptible birds can become infected with avian influenza virus when they contact with contaminated nasal, respiratory or fecal material from infected birds. Fecal-to-oral transmission is the most common mode of spread between birds. Most often, the wild birds that are host to the virus do not get sick, but they can spread influenza to other birds. Infection with certain avian influenza A viruses (for example, some H5 and H7 strains) can cause widespread disease and death. Domesticated birds may become infected with avian influenza virus through direct contact with infected waterfowl or other infected poultry or through contact with surfaces (such as dirt or cages) or materials (such as water or feed) that have been contaminated with virus. People, vehicles and other inanimate objects such as cages can be vectors for the spread of influenza virus from one farm to another. When this happens, avian influenza outbreaks can occur among poultry. Avian influenza outbreaks among poultry occur worldwide from time to time. Since 1997, for example, more than 16 outbreaks of H5 and H7 influenza have occurred among poultry in the United States. Low pathogenic forms of avian influenza viruses are responsible for most avian influenza outbreaks in poultry. Such outbreaks usually result in either no illness or mild illness (e.g., chickens producing fewer or no eggs) or low levels of mortality. 20
When highly pathogenic avian influenza H5 or H7 viruses cause outbreaks, about 90-100% of poultry can die from infection. For control of avian influenza outbreaks in poultry, quarantine and depopulation (or culling) and surveillance around affected flocks is the preferred control and eradication option (26).
21
III.
MATERIALS AND METHODS
1.
Cloning and expression of NP, HA, NA and NS1 gene
1.1.
Viruses and RNA extraction Avian influenza virus(AIV) A/chicken/cheongju/ADL0401/04
(H9N2) used in this study was isolated and characterized at Laboratory of Avian Disease, College of Veterinary Medicine, Chungbuk National University. RNA of AIV (H9N2) was extracted by using Trizol (Invitrogen). In brief, 0.3ml of allantoic fluid was mixed with 0.7ml of Trizol reagent and 0.2ml of chloroform/isoamylalcohol (24:1). After centrifugation at 10,000rpm for 10min, the RNA in the aqueous solution was precipitated by adding an equal volume of isopropanol. The RNA precipitate was collected by centrifugation at 10,000rpm for 10min, washed with 70% ethanol and finally dissolved in 50µl of RNase-free water. 1.2.
Primer design To amplify the NP, HA, NA and NS1 gene of AIV (H9N2),
individually, four primer sets based on conserved sequences of NP, HA, NA and NS1 gene of AIV (H9N2) were prepared as shown in Table 2. The conserved sequences were selected, compared and aligned from the GenBank of the National Center of Biotechnology Information (NCBI), USA. To facilitate the cloning of the gene into transfer vector, the restriction enzyme sites of XhoI and Hind III were added to the 5’ end of forward and reverse primers specific for
22
NP and HA gene, respectively. Also, restriction enzyme sites of Bgl II and Hind III were added to the 5’ end of forward and reverse primers specific for NA gene. 1.3.
Reverse
transcription
and
polymerase
chain
reaction
(RT-PCR) The reverse transcription step was performed in a reaction mixture containing following components: 5µl of extracted RNA, 4.5µl of RNase-free water, 3µl of dNTPs (2.5mM each), 2µl of Random primer (200pM/µl), 1µl of SuperscriptTM II RNase H-reverse transcriptase (200U/µl, Invitrogen), 0.5µl of RNase inhibitor (10U/µl) and 4µl of 5x first strand buffer. The mixture was incubated at 37°C for 60min and 94°C for 5min. PCR was carried out in a reaction mixture (25µl) containing 2.5µl of cDNA template, 2.5µl of 10x Ex Taq buffer (Takara), 2.5µl of dNTPs (2.5mM each), 1µl of each primer (30pM/µl each), 0.25µl of Taq (rTaq DNA polymerase: 5U/µl, Takara) and 15.25µl of RNase-free water. The PCR condition for amplification of NP, HA, NA and NS1 gene was 94°C for 4min, 35 cycles of 94°C for 1min (denaturation), 55°C for 1min (annealing), and 72°C for 2min (extension), followed by 72°C for 8min (final extension). The PCR products were examined on 1% agarose gel in 1x TAE buffer containing ethidium bromide. 1.4.
Cloning of the NP, HA, NA and NS1 gene For the NP and HA gene, each PCR product was digested with
XhoI and Hind III enzyme and then inserted into the XhoI and Hind III
23
sites of pBlueBac4.5/V5-His-TOPOR vector (Invitrogen) using T4 DNA ligase. Also, NA gene was digested with Bgl II and Hind III enzyme and inserted into the Bgl II and Hind III sites of the same transfer vector. For NS1 gene, the PCR product was inserted directly in to pBlueBac4.5/V5-His-TOPOR vector. The ligation mixtures were then transformed into competent E. coli DH5ɑ (Invitrogen), grown on LB agar plate containing antibiotic. The recombinant vectors were collected from blue colonies and checked the insert by restriction enzyme and sequencing analysis. 1.5.
Expression of the NP, HA, NA and NS1 gene
1.5.1. Generation of recombinant baculoviruses Recombinant baculoviruses were generated by cotransfecting insect cells with Bac-N-BlueTM DNA (Invitrogen) and a baculovirus transfer vector containing the gene of interest. Recombination will occur between homologous sequences in viral DNA and transfer vector to yield recombinant viral DNA that is circular and will replicate and infect cells. The procedure of recombinant baculovirus production
was
performed
according
to
the
Bac-N-Blue
Transfection and Expression Guide (Invitrogen). In brief, a 1.5ml microcentrifuge tube containing 10µl (0.5µg) of the Bac-N-BlueTM DNA was mixed with 4µl of recombinant transfer plasmid (1µg/µl) containing NP, HA, NA and NS1 gene, respectively, 1ml of Grace’s insect medium (without supplements or FBS), 20µl of CellfectinR reagent. The mixture of each was mixed gently and transfected with prepared monolayer of Spodoptera frugiperda (Sf9) cells in a 60mm 24
dish and incubated at 27°C. Seventy two hours after transfection, the CPE (cytopathic effect) of cells was checked and the supernatant was harvested and stored at 4°C for isolation of desire recombinant baculovirus. 1.5.2. Plaque assay Each recombinant baculovirus was plaque-purified by the following procedures. In brief, the prepared monolayer of Sf9 cells in a 60mm plate (5x106 cells/plate) was infected with 10-1, 10-2, 10-3 and 10-4 dilution of transfection viral stock and incubated at 25°C for 1h. The inoculum was removed and the overlay media containing 1% agarose and 0.16mg/ml of X-gal were added. The plates were incubated at 27°C until the plaques were formed. 1.6.
Confirmation of recombinant baculoviruses
1.6.1. Polymerase chain reaction (PCR) PCR was performed using specific primers for NP, HA, NA, NS1 and baculovirus polyhedrin gene to confirm if the recombinant baculoviruses contain the gene of interest or not and to determine the recombinant plaque and wild-type contamination. In brief, DNA of recombinant baculovirus was extracted following manual introduction of WizardR plus SV minipreps DNA purification kit (Promega). First, 0.5ml of recombinant baculovirus infected Sf9 cell supernatants putatively containing NP, HA, NA and NS1 gene, respectively, was mixed with 250µl of cell resuspension solution, 250µl of cell lysis solution, 10µl of alkaline protease solution and 350µl of neutralization 25
solution. The mixture was mixed well and centrifuged at 13,000rpm for 10min. The cleared cell lysate was transferred to prepared spin column and centrifuged at 13,000rpm for 1min. The column was washed one time with 750µl of column wash solution. Finally, the DNA binding to the column was eluted by adding 80µl of distil water and used as a template for PCR. PCR was carried out in a reaction mixture (25µl) containing 3.0µl of extracted DNA template, 2.5µl of 10x Ex Taq buffer, 2.5µl of dNTPs (2.5mM each), 1µl of each primer (30pM/µl each), 0.25µl of Taq (rTaq DNA polymerase-5U/µl) and 14.75µl of RNase-free water. The PCR condition using specific primers for NP, HA, NA and NS1 gene was 94°C for 5min, 35 cycles of 94°C for 1min, 55°C for 1min and 72°C for 2min. Additional time for final extension was 72°C for 8min. The PCR condition using specific primers for baculovirus polyhedrin gene was 94°C for 5min, 35 cycles of 94°C for 1min, 47°C for 1min and 72°C for 2min. Additional time for final extension was 72°C for 8min. The PCR products were examined on 1% agarose gel in 1x TAE buffer containing ethidium bromide. 1.6.2. Immunofluorescence assay (IFA) Each recombinant baculovirus expressing NP, HA, NA and NS1 proteins, respectively, was inoculated into the monolayer of Sf9 cells prepared in a 96-well plate. When the CPE appeared, the cells were fixed with 80% acetone for 10min, washed the plate three times with PBS (pH 7.2) and then air dried. The fixed cells were reacted with 50µl of diluted monoclonal antibodies (MAbs) specific for NP, HA, NA and NS1 protein of AIV (H9N2) or the commercial anti-His6
26
MAb (IG Therapy Co., Ltd) and incubated at 37°C for 1h. After washing three times with PBS, the cells were then stained with 50µl of diluted FITC-conjugated goat anti-chicken IgG or mouse IgG (Kirkegaard Perry Laboratories) and incubated at 37°C for 1h. Finally, the cells were washed three times with PBS, mounted in buffered glycerol (80%) and examined by fluorescence microscopy (Olympus). 1.6.3. Western immunoblotting Recombinant
proteins
were
characterized
by
Western
immunoblotting. For Western immunoblotting, each recombinant protein was purified under the native condition according to manual of the Ni-NTA purification system kit (Invitrogen). In brief, the Sf9 cells infected with NP, HA, NA and NS1-recombinant baculovirus were pelleted and resuspended individually in native binding buffer (50mM NaH2PO4, 0.5M NaCl). The lysate of Sf9 cells infected with recombinant baculovirus was then clarified by centrifugation to discard the cellular debris and added to a prepared purification column of Ni-NTA resin. After binding for 1h at 25°C and washing 4 times with native washing buffer (50mM NaH2PO4, 0.5M NaCl, 20mM imidazole), the proteins were eluted with native elution buffer (50mM NaH2PO4, 0.5M NaCl, 250mM imidazole). Protein concentrations were determined by measuring optical density (OD) at an absorbance of 280nm by spectrophotometry (Beckman). The purified recombinant proteins of NP, HA, NA and NS1 were electrophoresed on 10% vertical SDS-PAGE under denaturing 27
conditions and were then transferred to nitrocellulose membrane. The membrane containing proteins was washed one time with TBST (10mM Tris-HCl, 150mM NaCl, 0.1% Tween-20, pH 8.0) and then blocked in blocking buffer (5% skim milk in TBST) for 30min at 25°C. After washing with TBST, the membrane was reacted with AIV (H9N2)-positive chicken sera or anti-His6 MAb for 1h at 37°C with shaking and then washed three times with TBST. After washing, the diluted
alkaline
phosphatase-conjugated
secondary
antibody
(Kirkegaard Perry Laboratories) was added and incubated for 1h at 37°C. After washing the membrane three times with TBST, BCIP/NBT solution (Kirkegaard Perry Laboratories) was added as a substrate and waited about 15min for bands to appear.
28
2.
Production of monoclonal antibodies against NP, HA, NA and NS1 protein Monoclonal antibodies (MAbs) specific for NP, HA, NA and
NS1 protein of AIV (H9N2) were very important to characterize the antigenicity of expressed NP, HA, NA and NS1 protein using IFA, ELISA and Western blotting method. For production of NP, HA and NA-specific MAbs, the BALB/c mice were immunized with partially purified whole AIV (H9N2). For production of NS1-specific MAbs, the BALB/c mice were immunized with purified NS1 recombinant protein. In brief, the partially purified AIV (H9N2) and purified NS1 recombinant protein resuspended in PBS, pH 7.2 at a concentration of 1mg/ml, respectively, were emulsified in an equal volume of Freund’s adjuvant.
Fifty
microliters
of this
emulsion
were
inoculated
subcutaneously into each foot pad of BALB/c mouse. The inoculations were repeated every three days. The first inoculation was performed with complete Freund’s adjuvant and the subsequent two inoculations were done with incomplete Freund’s adjuvant. After three days following final inoculation, the mice were killed and the lymphocytes derived from popliteal lymph nodes and spleen were harvested and fused with the SP2/0 myeloma cells using polyethylene glycol 1500 (Boeringer Manheim). Hybridoma cells secreting MAbs specific for NP, HA, NA and NS1 protein were screened by immunofluorescence assay (IFA) and ELISA. For the IFA test, the antigens used were four different recombinant baculoviruses expressing NP, HA, NA and NS1 protein.
For ELISA, the antigen used were purified AIV (H9N2) for
screening of anti-NP, HA and NA MAbs and purified NS1 29
recombinant protein for screening of anti-NS1 MAbs. The positive hybridoma cells were subjected to cloning by limiting dilution methods and finally inoculated intraperitoneally into BALB/c mice primed with 2,6,10,14-tetramethylpentadecane. Ascitic fluid was collected 1 to 2 weeks later. The isotype of the each MAb was determined by commercial ELISA kit (Sigma) according to manual instruction. The immunoglobulin (IgG) was purified using IgG Purification Kit (Protein G Agarose Kirkegaard Perry Laboratories). The concentration of purified immunoglobulin was measured by coomassie protein assay method.
30
3. 3.1.
Serodiagnosis of AIV Indirect ELISA for detection of antibodies to NP (i-ELISA/NP)
3.1.1. Determination of an optimal concentration of coating antigen The optimal concentration of expressed NP protein as a coating antigen in i-ELISA/NP was determined by checkerboard titration. In brief, 100µl of carbonate-bicarbonate buffer (pH 9.6) were added to each well of the plates. One hundred microliters (20µg/ml) of purified NP recombinant protein were then added to all the wells of column 1, mixed well and transferred 100µl to column 2 (A-H). The transfer of dilutions was repeated till the column 11. After the last mixing, 100µl left in the pipet was discarded. The plates were incubated overnight at 4°C. After washing three time with washing buffer (PBS containing 0.05% Tween-20), the plates were saturated with 150µl/well of blocking buffer (PBS containing 5% skim milk and 0.05% Tween-20) and incubated for 1h at 37°C. After washing, 100µl of blocking buffer were added to each well of the plates and 100µl of a 1:25 dilution of positive chicken serum to AIV (H9N2) in blocking buffer were then added into the first row A, (1-12), mixed well and transferred 100µl to second row and mixed. The dilutions were repeated till the end of the plate (row H). The plates were incubated at 37°C for 1h. After washing, 100µl of peroxidase-labeled
goat
anti-chicken
IgG
(Kirkegaard
Perry
Laboratories) in washing buffer were added to the wells, incubated for 1h
at
37°C.
After
washing,
the
peroxidase
substrate
(o-phenylenediamine) was added to the wells, incubated for 3min at 31
room temperature. The substrate reaction was stopped by adding 50µl of 1.0M H2SO4 and the optical density (OD) was measured at 492nm. The optimal concentration of NP protein for coating ELISA was determined at a high dilution of NP protein in which the OD values started to decrease corresponding to NP protein dilutions (from column 1 to column 11). This meant that the binding capacity of NP protein to ELISA plate was saturated. 3.1.2. Determination of an optimal test serum dilution To determine the optimal test serum dilution in i-ELISA/NP, reference SPF chicken sera including 25 positive samples from experimentally infected or vaccinated with live AIV (H9N2) or killed AIV (H9N2) vaccine and 10 negative samples from SPF chickens were used. In brief, the ELISA plates were coated with purified NP recombinant protein (0.2μg/well). The plate was reacted with serial two-fold dilutions of SPF chicken serum starting from 1:50 to 1:6400 and then reacted with the peroxidase-labeled goat anti-chicken IgG and peroxidase substrate. The serum dilution of SPF chicken in which i-ELISA/NP could clearly differentiate the positive from negative sera would be used as a optimal serum dilution. 3.1.3. i-ELISA/NP The indirect ELISA (i-ELISA/NP) using NP-recombinant protein as a capture antigen was developed to detect the antibodies to NP of AIV in chicken population as shown in Fig 1(B). In brief, the plates were coated with 100µl/well of purified NP recombinant
32
proteins at a concentration of 2.0ug/ml in carbonate-bicarbonate buffer and incubated at 37°C for 2h or overnight at 4°C. The wells were saturated with 150µl/well of blocking buffer, incubated for 1h at 37°C and then washed three times with washing buffer. One hundred microliters per well of a 1:500 dilution of each test chicken serum in blocking buffer was added into appropriate wells and incubated for 1h at
37°C.
After
washing,
100µl of
peroxidase-labeled
goat
anti-chicken IgG in washing buffer was added to the wells and the mixtures were incubated for 1h at 37°C. After washing, the peroxidase substrate was added to the wells and the mixtures were incubated for 3min at room temperature. The substrate reaction was stopped by adding 50µl of 1.0M H2SO4. The OD values were measured at 492nm and the cutoff value was set as the mean OD values for control sera plus 3 standard deviations (SD). The OD values of test sera greater than or equal to cutoff value were considered positive. 3.1.4. Sensitivity and specificity of i-ELISA/NP In order to determine if the i-ELISA/NP for detection of antibodies to AIV has cross-reaction with other relative antisera of IBDV and NDV or not, the i-ELISA/NP was applied to the antisera of IBDV and NDV. The i-ELISA/NP was done in the same way when applied to diagnosis of AIV. The antisera of IBDV and NDV were also diluted at 1:500. To compare the sensitivity and specificity of i-ELISA/NP for diagnosis of AIV to other methods, the HI test, IDEXX FlockChek kit test and indirect ELISA using whole purified AIV H9N2 were also established. HI test was performed as described
33
previously (ref). In brief, the HA test was firstly set up to determine the HA titer of AIV (H9N2). Fifty microliters of two-fold serial dilutions of AIV starting from 1:2 to 1:2,048 in PBS (pH 7.2) were prepared in a 96-well plate. Fifty microliters of 0.5% chicken red blood cells (RBCs) suspended in PBS was then added to all wells including those of cell and buffer controls. The plate was incubated at room temperature for 30min. The positive hemagglutination was read as a complete red lattice formation. End points can be read as the highest virus dilutions giving complete HA-pattern and HA titers were calculated as the reciprocals of end points. For HI test, 25µl of two-fold serial dilutions of chicken sera starting from 1:2 to 1:2,048 in PBS were prepared in a 96-well plate. Twenty five microliter volumes of AIV (H9N2) containing 4 HA units were added to all wells and incubated at room temperature for 30min. Fifty microliters of 0.5% chicken red blood cells suspended in PBS was then added to all wells and incubated at room temperature for 30min. Positive HI reactivities gave the button-like pattern of chicken RBCs, where HI titer was the reciprocal of the highest dilution of antisera blocking completely
the
hemagglutination.
The
procedure
for
IDEXX
FlockChek kit test was done according to manual introduction. In brief, 100µl of undiluted negative control were added into wells A1 and A2, and 100µl of undiluted positive control were added into wells A3 and A4 of an antigen-coated 96-well plate. One hundred microliters of a 1:500 dilution of sample were added into appropriate wells and incubated at 37°C for 30min. After washing three times with PBS, 100µl of peroxidase-conjugated goat anti chicken were added into all wells and incubated at 37°C for 30min. After washing, 100µl of TMB 34
substrate solution were added into all wells and incubated at 37°C for 15min. One hundred microliters of stop solution were then added into all wells to stop the reaction and measured the absorbance values at 650nm. The i-ELISA using whole purified AIV (H9N2) as a coating antigen was performed. The procedure done was the same as i-ELISA/NP except the whole purified AIV (H9N2) was used as a coating antigen instead of purified NP recombinant protein.
35
3.2.
Indirect capture ELISA for differentiation of naturally infected chickens from vaccinated ones (i-capture ELISA/NS)
3.2.1. Determination of an optimal concentration of capture antibody To set up the i-capture ELISA/NS for differentiation of naturally infected chickens from vaccinated ones to AIV (H9N2), the optimal concentration of anti-NS1 MAb as a capture antibody was determined by checkerboard titration method. In brief, 100µl of carbonate-bicarbonate buffer were added to each well of the plate. One hundred microliters (20µg/ml) of purified anti-NS1 MAb was then added to all the wells of column 1, mixed well and transferred 100µl to column 2 (A-H). The transfer of dilutions was repeated till the column 11. The plate was then saturated with blocking buffer, treated with peroxidase-labeled goat anti-mouse IgG (Kirkegaard Perry Laboratories) and finally the peroxidase substrate was added to the wells. The optimal concentration of capture antibody for coating ELISA was determined at a high dilution of capture antibody in which the OD value started to decrease corresponding to antigen dilutions (from column 1 to column 11). 3.2.2. Determination of an optimal concentration of expressed NS1 protein In addition to determination of capture antibody, the optimal concentration of expressed NS1 protein was also titrated. In brief, the plate was coated 0.1μg/well of capture antibody, saturated with blocking buffer and then treated with serial two-fold dilutions of
36
expressed NS1 protein, positive chicken serum, peroxidase-labeled goat anti-chicken IgG and finally the peroxidase substrate was added to the wells. The optimal concentration of NS1 protein was determined at a high dilution of antigen in which the OD values started decreasing corresponding to antigen dilutions (from column 1 to column 11). 3.2.3. Determination of an optimal test serum dilution To determine the optimal test serum dilution in which i-capture ELISA/NS could differentiate the naturally infected chickens from vaccinated ones with AIV (H9N2), reference SPF chicken sera were used. The procedure was done as the same method performed in i-ELISA/NP in determination of an optimal serum dilution except capture antibody was used instead of NP protein for coating ELISA. The purified NS1 recombinant protein was then bound to capture antibody, treated with serial two-fold dilutions of SPF chicken serum, peroxidase-labeled goat anti-chicken IgG, and finally the peroxidase substrate was added to the wells. The OD values were measured at 492nm. The serum dilution of SPF chicken in which i-capture ELISA/NS could clearly differentiate the naturally infected chickens from vaccinated ones would be used. 3.2.4. i-capture ELISA/NS The i-capture ELISA/NS using NS1 recombinant protein as a specific marker was developed to differentiate the naturally infected chickens from vaccinated ones as shown in Fig 1 (A). In brief, the
37
plates were coated with 100µl/well of NS1 specific purified MAb as a capture
antibody
(1.0µg/ml)
in
carbonate-bicarbonate
buffer,
incubated at 37°C for 2h or overnight at 4°C. The wells were saturated with 150µl/well of blocking buffer, incubated for 1h at 37°C and then washed three times with washing buffer. One hundred microtiters of purified NS1 recombinant protein at a concentration of 2.0µg/ml in blocking buffer were added into all wells and incubated at 37°C for 1h. After washing, 100µl/well of a 1:200 dilution of test sera in blocking buffer was added, incubated for 1h at 37°C. After washing, 100 µl of peroxidase-labeled goat anti-chicken IgG diluted in washing buffer was added into all wells and the mixtures were incubated for 1h at 37°C. After washing, the peroxidase substrate was added to the wells and the mixtures were incubated for 3min at room temperature. The substrate reaction was stopped by adding 50µl of 1.0M H2SO4 and OD values were measured at 492nm.
38
Table 2. Specific primer sequences used in this study Gene
Sense
NP
HA
NA
NS
+
GATCTCGAGTCATGGCGTCTCAAGGCACCA
-
ATCAAGCTTATTGTCATATTCTTCTGCA
+
GATCTCGAGTCATGGAAATAATAGCACTAA
-
ATCAAGCTTTATACAAATGTTGCATCTG
+
GATAGATCTTCATGAATCCAAATCAGAAAAT
-
ATCAAGCTTTATAGGCATAAAATTGATA
+
GTTATGGATTCCAACACTGTGTCA
-
AACTTCTGGCTCAATTGTTCT
Polyhedrin + (Baculovirus)
Sequence (5’- 3’)
-
Size (bp) 1,500
1,683
1,410
TTTACTGTTTTCGTAACAGTTTTG CAACAAC GCACAGAATCTAGC
CTCGAG: Xho I site, AAGCTT: Hind III site, AGATCT: Bgl II site
39
890
839
A
B
Fig. 1. Indirect (B) and capture ELISA (A) procedures for sero-diagnosis of avian influenza virus H9N2
40
IV.
RESULTS
1.
Expression of NP, HA, NA and NS1 gene Amplification of the NP, HA, NA and NS1 gene of AIV (H9N2)
was achieved using reverse transcription and PCR with specific primer sets. The amplified gene of NP, HA, NA and NS1 had 1,500bp, 1,683bp, 1,410bp and 890bp in size, respectively, which were in agreement with expected nucleotides of NP, HA, NA and NS1 gene of AIV (H9N2) (Fig. 2). Recombinant
baculoviruses
have
been
generated
by
transfection between Bac-N-BlueTM DNA and pBlueBac4.5/V5His-TOPOR transfer vector containing NP, HA, NA and NS1 gene, respectively, in Sf9 cells. The CPE was detected after 72h. After 72h of transfection, the supernatant of infected Sf9 cells was subjected to plaque assay and recombinant plaques were easily distinguished from non-recombinant, because the transfer vector with lacZ gene made recombinant baculovirus blue plaque. Recombinant baculoviruses, which expectedly contained NP, HA, NA and NS1 gene, were cultured respectively and confirmed finally by PCR using specific primers for NP, HA, NA and NS1 gene of AIV (H9N2).
41
M
NP
HA
NA
NS1
Fig. 2. Amplification of NP, HA, NA and NS1 gene of AIV (H9N2) by RT-PCR. M: 1Kb plus DNA ladder, NP: nucleocapsid gene, HA: hemagglutinin gene, NA: neuraminidase gene, NS1: nonstructural protein gene.
42
The results showed that the amplified genes of NP (1,500bp), HA (1,683bp), NA (1,410bp) and NS1 (890bp) were in agreement with expected sizes. In addition to PCR using NP, HA, NA and NS1-specific primers, PCR using baculovirus polyhedrin gene primers was also used to determine the recombinant plaque and wild-type contamination. The results showed that the amplified genes of NP, HA, NA and NS1 plus the size of the DNA (435bp) contributed by the transfer vector were in agreement with expected sizes (Fig. 3). Recombinant proteins expressed in baculovirus expression system were assayed for antigenicity using IFA and Western blotting method with MAbs specific for NP, HA, NA and NS1 protein of AIV (H9N2) and His6-specific MAb. IFA analysis showed that all four recombinant baculoviruses expressing NP, HA, NA and NS1 protein, respectively, reacted strongly with His6-specific MAb (row A). In parallel to the use of His6-specific MAb, the MAbs specific for NP, HA, NA and NS1 protein of AIV (H9N2) were also used to check if four recombinant baculoviruses expressing NP, HA, NA and NS1 protein, respectively, reacted with related MAbs or not. The results showed that all four recombinant baculoviruses reacted specifically with each MAb, correspondingly, and had no cross-reaction with unrelated MAbs (row B, C, D and E) (Fig. 4). Western blot analysis showed that 56.1 (NP), 82.5 (HA), 50.0 (NA) and 26.8 (NS1) kDa protein band, which were in agreement with the expected molecular mass of the protein, were presented in recombinant baculoviruses in infected Sf9 cell lysates (Fig. 5). 43
M
1
2
3
4
5
6
7
8
9
Fig. 3. Confirmation of NP, HA, NA and NS1 gene of recombinant baculovirus by PCR. M: 1Kb plus DNA ladder. Lane 1, 2, 3, 4: PCR fragments of NP, HA, NA and NS1 gene using NP, HA, NA and NS1-specific primer sets, respectively. Lane 5, 6, 7, 8: PCR fragments of NP, HA, NA and NS1 gene using baculovirus polyhedrin gene primer sets. Lane 9: PCR fragment (839bp) of wild-type baculovirus using baculovirus polyhedrin gene primer sets.
44
1
2
3
4
5
A
B
C
D
E
Fig. 4. Detection of expressed NP, HA, NA and NS1 protein of recombinant baculovirus in Sf9 cells by indirect immunofluorescence assay (IFA). Column 1: Mock-infected Sf9 cells as a negative control.
Column 2, 3, 4 and 5: Sf9 cells infected with NP, HA, NA and NS1-recombinant baculoviruses, respectively. Row A, B, C, D and E: Mock-and recombinant baculovirus-infected Sf9 cells were reacted with His6, NP, HA, NA and NS1-specific MAb, respectively.
45
M
NP
HA
NA
NS
kDa 100 70 50 40 30
Fig. 5. Detection of expressed NP, HA, NA and NS1 protein by Western blotting. The purified recombinant proteins of NP, HA, NA and NS1 were separated on a 10% polyacrylamide gel and then transferred to nitrocellulose membrane and immunostained with His6-specific MAb.
46
2.
Production of monoclonal antibodies against NP, HA, NA and NS1 protein A total of 8 monoclonal antibodies (MAbs) were produced.
They were specific for proteins of NP (5E7, 6B5), HA (3G7, 1D7), NA (9D7, 8H9) and NS1 (7D6, 6D2) of AIV (H9N2). The isotype of MAbs 3G7, 8H9 and 6D2 were identified as IgG1, MAbs 5E7, 6B5 and 9D7 were as IgG2a, and MAbs 7D6 and 1D7 were as IgG2b. The MAbs were then characterized by ELISA and IFA test. The results showed that all 8 MAbs were positive with IFA and ELISA (Table 3).
47
Table 3. Characterization of NP, HA, NA and NS1 protein-specific monoclonal antibodies
Reactivity pattern by: MAb
1
Immunogen
Isotype IFA
ELISA
5E7
Whole AIV1
G2a
+
+
6B5
//
G2a
+
+
3G7
//
G1
+
+
1D7
//
G2b
+
+
9D7
//
G2a
+
+
8H9
//
G1
+
+
7D6
rNS12
G2b
+
+
6D2
//
G1
+
+
Whole purified AIV (H9N2). 2 Purified recombinant NS1 protein
48
3.
Serodiagnosis of AIV
3.1.
Indirect ELISA for detection of antibodies to NP (i-ELISA/NP)
3.1.1. Determination of an optimal concentration of capture antigen To determine the optimal concentration of NP recombinant protein for coating antigen in i-ELISA/NP, checkerboard titration was performed. The results showed that the OD values at the concentration of 1, 0.5 and 0.25μg/well were nearly similar and started to decrease from the concentration of 0.13μg/well. This meant that the binding capacity of antigen to the plate was saturated at the concentration of between 0.13μg and 0.25μg. Therefore, the optimal concentration of expressed NP protein as a coating antigen in i-ELISA/NP was determined as 0.2μg/well (Fig. 6A). 3.1.2. Determination of an optimal test serum dilution In parallel to determination of optimal antigen concentration for coating ELISA, the test serum dilution which could clearly diagnose of the infected from non-infected chickens to AIV (H9N2) was determined. The i-ELISA/NP with a serial dilution of SPF chicken sera showed that the OD values of negative sera were decreasing according to serum dilution starting from 1:50 dilution and stopping at the dilution of about 1:500. In contrast, the OD values of all positive sera were very high and were also decreasing according to serum dilution but had no stop at the last dilution of 1/6400. This meant that the antibody titer to AIV (H9N2) of positive sera was very high. In other words, the serum dilution used in i-ELISA/NP was 49
1:500 in which it could clearly diagnose the infected chickens from non-infected ones to AIV (H9N2) of chicken populations (Fig. 7). 3.1.3. Sensitivity and specificity of i-ELISA/NP In
order
i-ELISA/NP
with
to
determine
other
relative
the
cross-reactivity
sera
when
applied
of
the
to
the
serodiagnosis of AIV (H9N2)-infected chickens, the i-ELISA/NP was performed using known positive chicken sera for IBDV and NDV. The IBDV and NDV together with AIV caused the common diseases in chickens. These sera were all negative for AIV by HI test. The result showed that 7 of the 50 IBDV-positive and 1 of the 70 NDV-positive chicken sera were AIV (H9N2) positive with i-ELISA/NP while they were all negative with HI test for AIV (H9N2). The OD values (data not shown) were very low and ranged from 0.182 to 0.322 (Table 4).
50
A 3 2.5
OD
2 1.5 1 0.5 0 1
0.5
0.25 0.13 0.06 0.03 0.02 0.01
0
0
0
0
Re c o mbin an t pro te in dilu tio n ( u g/ w e ll)
B 3 2.5
OD
2 1.5 1 0.5 0 1
0.5
0.25 0.125 0.062 0.031 0.015 0.007 0.003 0.0015 0.0009 0.0004
Capture antibody dilution (ug/well)
Fig. 6. Determination of an optimal concentration of expressed NP protein (A) as a coating antigen and NS1-specific MAb (B) as capture antibody by
checkerboard titrations.
51
A 3
OD. 492 nm
2.5 2 1.5 1 0.5 0 50
100
200
400
800
1600
3200
6400
3200
6400
Se ru m dilu tio n
B 3
OD. 492 nm
2.5 2 1.5 1 0.5 0 50
100
200
400
800
1600
S er um dilution Fig. 7. Determination of optimal serum dilution for i-ELISA/NP using 25 positive (A) and 10 negative (B) reference sera to AIV (H9N2).
52
Table 4. Results of i-ELISA/NP using known positive chicken sera for IBDV and NDV
Group
No. of samples
Reactivity against following virus:
IBDV1
1
NDV2
AIV3
HI
i-ELISA/NP
I
50
50/504
0/50
0/50
7/50
II
70
0/70
70/70
0/70
1/70
IBDV: Infectious bursal disease virus. Antibody to IBDV was confirmed
by agar gel immunodiffusion test.
2
NDV: Newcastle disease virus.
Antibody to NDV was confirmed by HI test. 3 AIV: Avian influenza virus. Antibody to AIV was confirmed by HI and ELISA test. sera/No. of tested sera.
53
4
No. of positive
To compare the sensitivity and specificity of i-ELISA/NP to other methods for diagnosis of AIV (H9N2), HI, IDEXX FlockChek kit test and i-ELISA using whole purified AIV (H9N2) were also established. The test results of HI, i-ELISA/NP and indirect ELISA using whole purified AIV revealed the similar results. 145 of the 225 serum samples were positive with AIV (H9N2). In contrast, the number of positive serum samples in the total serum samples tested with IDEXX FlockChek kit test was much less than those ones tested with HI test, i-ELISA/NP and indirect ELISA using whole purified AIV (H9N2), only 105 among 225 samples were positive with IDEXX FlockChek kit test (Table 5). For the i-ELISA using whole purified AIV (H9N2), the optimal concentration of whole virus for coating ELISA plate was determined as 0.1μg/well. The OD values of test sera greater than or equal to 0.527 (cutoff value) were considered positive for AIV (H9N2).
54
Table 5. Sensitivity and specificity of i-ELISA/NP in comparison wit HI test, IDEXX FlockChek kit test and i-ELISA using whole purified AIV (H9N2)
FlockChek Positive
Negative
Total
i-ELISA/NP1
Positive
105
40
145
i-ELISA/whole virus2
Negative
0
80
80
HI3 1
Total
105
120
225
Indirect ELISA using NP recombinant protein. 2 Indirect ELISA using whole
purified AIV (H9N2).
3
Hemagglutination inhibition test.
55
3.1.4. i-ELISA/NP for serodiagnosis of AIV The i-ELISA/NP has been applied to sero-diagnose of AIV (H9N2) using chicken sera. Two hundred and twenty five serum samples collected from chickens in the field were tested with i-ELISA/NP. The OD values of test sera greater than or equal to 0.176 (cutoff value) were considered positive for AIV (H9N2). The results showed that 145 of the 225 serum samples were AIV positive. The results obtained were in agreement with those tested by HI test and i-ELISA using whole purified AIV (H9N2). The OD values for positive sera range from 0.294 to 2.170 (Fig. 8). These results have demonstrated that the i-ELISA/NP could clearly provide the presence or absence of antibodies to AIV (H9N2) by using a 1:500 dilution of chicken sera.
56
Negative
A
Positive
3
OD. 492. nm
2.5 2 1.5 1 0.5 0
Refer enced sa m ples
B 3
OD. 492 nm
2.5 2 1.5 1 0.5 0
Field sa m ples
Fig. 8. Representatives to indirect ELISA with a 1:500 dilution of reference (A) and test (B) sera against purified NP recombinant protein (0.2μg/well). The first ten serum samples for each figure are negative sera.
57
3.2.
Indirect capture ELISA for differentiation of naturally infected sera from vaccinated ones (i-capture ELISA/NS)
3.2.1. Determination of an optimal concentration of capture antibody Checkerboard titration to determine the optimal capture antibody concentration for coating antigen in i-capture ELISA/NS was performed. The results showed that the OD values at the concentration of 1, 0.5, 0.25 and 0.125μg/well were nearly similar and started to decrease from the concentration of 0.062μg/well. This also meant that the binding capacity of capture antibody to the plate was saturated at the concentration of between 0.125μg and 0.062μg. Therefore, the optimal concentration of capture antibody as a coating antigen in i-capture ELISA/NS was determined as 0.1μg/well (Fig. 6B) 3.2.2. Determination of an optimal concentration of NS1 recombinant protein Checkerboard
titration
to
determine
the
optimal
NS1
recombinant protein concentration for binding with capture antibody in
i-capture
ELISA/NS
was
also
performed.
The
optimal
concentration of NS1 protein used in i-capture ELISA/NS for recognition of anti-NS1 antibodies was determined as 0.2μg/well (date not shown). 3.2.3. Determination of an optimal test serum dilution In
parallel
to
the
determination 58
of
capture
antibody
concentration for coating antigen in i-capture ELISA/NS, the serum dilution which could clearly differentiate the naturally infected chickens from the vaccinate ones was determined. The results (not shown) revealed that the i-capture ELISA/NS could clearly differentiate the naturally infected chickens from the vaccinate ones at the serum dilution of 1:200. 3.2.4. i-capture ELISA/NS The i-capture ELISA/NS was first applied to the reference SPF chicken sera. The result revealed that 15 serum samples of vaccinated SPF chickens were negative, whereas 10 serum samples of experimentally infected SPF chickens with live AIV (H9N2) were positive by i-capture ELISA/NS (Table 6). The OD values of the positive samples ranged from 0.426 to 1.072 in comparison with the positive OD cutoff value, 0.178. This results indicated that the i-capture ELISA/NS could clearly differentiate the naturally infected samples from the vaccinate ones using SPF reference sera. Indirect capture ELISA/NS was also applied to the field samples to differentiate the naturally infected chickens from vaccinated ones. The results revealed that 10 of the 60 sera from vaccinated chickens and 16 of the 60 sera from naturally infected chickens were positive by i-capture ELISA/NS (Table 7). The OD values of positive samples ranged from 0.184 to 0.553 and were not so high in comparison with the positive OD cutoff value. These results showed that the i-capture ELISA/NS could not clearly differentiate the naturally infected samples from the vaccinated ones of the field sera.
59
Table 6. Indirect capture ELISA/NS for differentiation of naturally infected sera from vaccinated ones using SPF reference sera
i-capture ELISA/NS Positive
Negative
Total
Infected
10
0
Vaccinated
0
15
Negative
0
10
10
Total
10
25
35
Positive
HI test
60
10 15
Table 7. Indirect capture ELISA/NS for differentiation of naturally infected sera from vaccinated ones using field samples.
i-capture ELISA/NS Positive Positive
HI test
16
Infected
10
Vaccinated
Negative
44 50
Total
60 60
Negative
0
10
10
Total
26
104
130
61
V.
DISCUSSION The detection of avian influenza virus (AIV) infected poultry
based on the recognition of anti-nucleocapsid (NP) antibody of AIV has been done by other researchers (27, 51). Nucleocapsid (NP), an important protein in the life cycle of influenza viruses, represents a key marker of ongoing viral replication. NP and the viral RNA are associated in virions and infected cells in the form of viral ribonucleoprotein particles (vRNPs). Expression of NP in infected cells occurs at an advanced step of the virus life cycle, being dependent on efficient virus adsorption, internalization, uncoating, and mRNA synthesis. NP is relatively well conserved among the type A influenza viruses and is an ideal target for antibody-base detection (27,
34).
Baculovirus
expression
systems
have
been
used
successfully for production of antigens for the diagnosis of viral diseases (57, 64). In this study, therefore, the baculovirus expression system has been employed for generation of recombinant proteins encoding by NP, HA, NA and NS1 gene of AIV (H9N2), respectively. The NP and NS1 recombinant protein was then used as specific antigens for diagnosis of AIV using ELISA system. The HA and NA recombinant protein were not used in ELISA system for diagnosis of AIV because of the limitation of function of our University that we have no standard laboratory for influenza as well as permission of handling other strains of AIV except AIV (H9N2). So we could not establish ELISA based on the use of expressed HA and NA protein to check if they could be distinguished itself or not from different HA and NA subtypes of AIV although the antigenicity 62
of expressed HA and NA protein has been confirmed as positive by FA test and Western blotting method. It has been reported that the ELISA system using expressed HA protein for diagnosis of equine influenza had been set up successfully (57). In our study, the i-ELISA/NP using NP recombinant protein as a specific antigen has been developed as a sensitive tool for detection of antibodies to AIV (H9N2). In comparison between i-ELISA/NP and IDEXX FlockChek kit test results indicated that the i-ELISA/NP was much more sensitive than the IDEXX FlockChek kit test. This sensitivity was in agreement with Jin’s report (27) that NP47-384-ELISA was more sensitive than IDEXX FlockChek kit test. In comparison the results between i-ELISA/NP and NP47-384-ELISA indicated that the positive cutoff value of NP47-384-ELISA was 0.4 while that of i-ELISA/NP was 0.176, the optimal serum dilution for NP47-384-ELISA was 1:40 while 1:500 for i-ELISA/NP, and the number of positive samples tested by NP47-384-ELISA in comparison with IDEXX FlockChek kit test was 118/100 while those of i-ELISA/NP were 145/105. The higher background and lower optimal serum dilution of NP47-384-ELISA in comparison with i-ELISA/NP may be explained that the NP47-384 protein, which was expressed in E. coli expression system, was not well purified and still contained E. coli proteins. Furthermore, antibodies induced from E.
coli residing naturally in intestine of chickens may react with E. coli proteins remaining in purified NP47-384 protein. These reasons may cause background and reduce the sensitivity of test. In contrast, the NP recombinant protein used in i-ELISA/NP was expressed in 63
baculovirus expression system so that these obstacles were overcomed. The present study demonstrates that the i-ELISA/NP was highly sensitive and specific for detecting antibodies in chickens vaccinated or infected with AIV. Development of the i-ELISA/NP significantly contributed to the ability of quick detection of the antibodies to AIV during the field outbreaks. The sensitivity of i-ELISA/NP was compared with HI test and i-ELISA using whole purified virus. HI test is considered the gold standard for routinely serologic diagnosis of infection with avian influenza viruses but the HI test was reported to be less sensitive for detecting antibodies to avian influenza viruses (20, 47, 49). Sensitivity of HI test was less sensitive than ELISA assay for detecting immune sera of AIV (49). The results of sensitivity comparison between HI test and i-ELISA/NP showed that there was no difference between two methods in recognition of antibodies to AIV. Comparison of the sensitivity between i-ELISA/NP and HI test was similar with that of NP47-384-ELISA (27). It was said that, the HI test was a highly strain specific assay and less sensitive so that the ELISA would be more useful than HI test in the disease diagnosis and surveillance of antibodies to AIV H9N2 in poultry population (57). For i-ELISA using whole purified AIV (H9N2), although the result of sensitivity was the similar with i-ELISA/NP, the background was much higher than that of i-ELISA/NP. This maybe that whole purified H9N2 viruses was not pure and still contaminated with proteins of embryonated chicken eggs. Moreover, whole purified H9N2 viruses contained more antigenic sites than expressed NP protein in 64
responding to the AIV-antisera, and those reasons maybe cause the high background of test. In practice, the ELISA is both highly sensitive and time conserving although the specificity of test depends on the quality of the antigen used. The ELISA could be set up to test a large number of field sample in a short time. Infectious bursal disease (IBD) and Newcastle disease (ND) are two common diseases together with AIV in chicken populations. Chickens could be infected simultaneously by IBDV, NDV and AIV. The specificity test using i-ELISA/NP, therefore, was performed with known positive sera of IBDV and NDV. The results showed that nearly all known positive sera for IBDV and NDV were negative with i-ELISA/NP although very few of them were positive. This may be that the immunization experiments with IBDV and/or NDV vaccine were done on commercial chickens instead of SPF chickens and were carried out in the field conditions. So the commercial chickens may be exposed naturally to live AIV. Therefore, immune sera of chickens may also contain antibodies against AIV. Moreover, it was reported that the NP47-384-ELISA using expressed NP47-384 protein showed positive results with known positive sera for AIV subtypes of H3N1, H5N1, H7N1, and H9N2, and did not react with known positive sera for ND, IBD, IB, ILT, MD, and FA (27). To
differentiate
the
naturally
infected
animals
from
vaccinated ones to influenza virus, the non-structural (NS1) protein has been employed by other researchers (3, 40, 59). NS1 is antigenically and genetically conserved among influenza A viruses.
65
NS1 protein only appears in infected cells so the chickens vaccinated with inactivated viruses will not be exposed to this antigen, whereas those suffering a viral infection will. The NS1 protein would therefore appear to be a key candidate for a differential diagnostic marker, capable of distinguishing naturally infected from vaccinated chickens. In this study, NS1 gene of AIV (H9N2) has been expressed successfully in baculovirus expression system. Indirect capture ELISA using expressed NS1 protein (i-capture ELISA/NS) as a specific antigen for sero-differentiation of naturally infected chickens from vaccinated ones has been set up. The results revealed somewhat difference between reference and field sera. Even though i-capture ELISA/NS could clearly differentiate the naturally infected reference sera from vaccinated ones, it was not clear to differentiate the field sera. This may be the limitation or lack of immunogenic characteristic of expressed NS1 protein in comparison with NS1 protein in infected cells. Moreover, the field chickens could be exposured to other disease by chance in comparison with SPF chickens. In comparison with other reports (40, 59), the i-capture ELISA/NS for testing the naturally infected reference sera from vaccinated ones indicated the same result. Even though i-capture ELISA/NS was more convenient because the serum diluent used in Tumpey’s report (59) needed E. coli cell lysate, and the test sera should be inactivated at 56oC for 30min before testing while the i-capture ELISA/NS did not need and serum samples was subjected to testing directly. This was because of NS1 protein used in Tumpey’s report was expressed in E. coli expression system. These results one more indicate that the baculovirus expression system is 66
more useful than E. coli expression system. For the field application, although the results obtained in Tumpey’s report were successful in differentiation of the naturally infected sera from vaccinated ones using ELISA/NS1, the OD values of positive samples were not so high in comparison with positive cutoff value. This meant that the results obtained in Tumpey’s report seemed to be not so reliable. The results obtained in Ozaki’s report (40) was just done on experimental samples and not done on field samples. This meant that the field application is still not clear for this report. NS1 protein was also expressed in Birch’s report (3) and used as a specific antigen for detection of anti-NS1 antibody in experimentally post infection equine sera but they used the immunoblot method for detection of antibodies to equine influenza and ELISA/NS1 was not yet employed. To overcome the problems of i-capture ELISA/NS in this study, the competitive and Biotin-avidin ELISA system using NS1 recombinant protein as a specific marker for differentiation of the naturally infected chickens for vaccinated ones should be done next time because these methods were said to be more sensitive and specific. To date, there are no commercial ELISA kits in use for differentiation of the naturally infected reference sera from vaccinated ones to AIV using NS1 protein.
67
VI.
CONCLUSIONS
1.
The expression of NP, HA, NA and NS1 gene of AIV (H9N2) was successful using baculovirus expression system
2.
The recombinant proteins encoded by NP, HA, NA and NS1 gene of AIV (H9N2) were assayed positively for antigenicity using Western blotting and FA methods.
3.
The
indirect
(i-ELISA/NP)
ELISA was
using
developed
NP
recombinant
successfully
protein
for
sero-
diagnosis of AIV (H9N2) infection in poultry population. 4.
The i-ELISA/NP has no cross-reactivity with known positive sera for IBDV and NDV. The i-ELISA/NP is very sensitive and specific in comparison with IDEXX FlockChek kit test.
5.
Indirect capture ELISA (i-capture ELISA/NS) using NS1 recombinant protein of AIV (H9N2) has been set up in order to sero-differentiate the naturally infected chickens from vaccinated ones. The i-capture ELISA/NS could clearly differentiate the naturally infected from vaccinated sera of reference sera but not clear when applied to field sera.
68
REFERENCES 1.
Alexander, D.J. A review of avian influenza in different bird species. Vet Microbiol 74. 3-13, 2000.
2. Alexander, D.J. The epidemiology and control of avian influenza and Newcastle disease. J Comp Pathol 112. 105-126, 1995. 3. Birch M.I., Rowan A., Pick J., Mumford J., Binns M. Expression of the nonstructural protein NS1 of equine influenza A virus: detection of anti-NS1 antibody in post infection equine sera. J
Virol Methods 65. 255-263, 1997. 4.
Bourmakina, S.V., Garcia-Sastre, A. Reverse genetics studies on the filamentous morphology of influenza A virus. J Gen Virol 84. 517-527, 2003.
5. Brammer, L., Fukuda, K., Arden, N., Schmeltz, L.M., Simonsen, L., Regnery,
H.L.,
Schonberger,
surveillance-United
States,
L.B.,
Cox,
1992-1993
N.J.
and
Influenza
1993-1994.
Morbid Mortal Wkly Rep CDC Surveill Summ 46. 1-12, 1997. 6. Brown, I. H. The epidemiology and evolution of influenza viruses in pigs. Vet Microbiol 74. 29-46, 2000. 7. Brown, P., Gajdusek, D.C., Morris, J.A. Epidemic A2 influenza in isolated Pacific island populations without pre-epidemic antibody to influenza virus types A and B, and the discovery of other still unexposed populations. Am J Epidemiol 83. 176-188, 1966. 8.
Capua, I,. Alexander, D.J. Avian influenza and human health. Acta
Trop 83. 1-6, 2002. 9. Chin, P.S., Hoffmann, E., Webby, R., Webster, R.G., Guan, Y., Peiris, M., Shortridge, K.F. Molecular evolution of H6 influenza 69
viruses from poultry in Southeastern China: prevalence of H6N1 influenza
viruses
possessing
seven
A/Hong
Kong/156/97
(H5N1)-like genes in poultry. J Virol 76. 507-516, 2002. 10. Colman, P.M., Lawrence, M.C. The structural biology of type I viral membrane fusion. Nat Rev Mol Cell Biol 4. 309-319, 2003. 11. Colman, P.M., Tulip, W.R., Varghese, J.N., Tulloch, P.A., Baker, A.T., Laver, W.G., Air, G.M., Webster, R.G. Three-dimensional structures of influenza virus neuraminidase- antibody complexes.
Philos Trans R Soc Lond B Biol Sci 323. 511-518, 1989. 12. Cox, N.J., Subbarao, K. Influenza. Lancet 354. 1277-1282, 1999. 13. De Jong, J.C., Rimmelzwaan, G.F., Fouchier, R.A., Osterhaus, A.D. Influenza virus: a master of metamorphosis. J Infect 40. 218-228, 2000. 14. Erin, M.S. Adaptation of A/mallard/Potsdam/178-4/ 83(H2N2) in Japanese quail leads to replication and transmission in chickens.
MS Thesis, University of Maryland, 2005. 15. Guan, Y., Shortridge, K.F., Krauss, S., Chin, P.S., Dyrting, K.C., Ellis, T.M., Webster, R.G., Peiris, M. H9N2 influenza viruses possessing H5N1-like internal genomes continue to circulate in poultry in southeastern China. J Virol 74. 9372-9380, 2000. 16. Guan, Y., Shortridge, K.F., Krauss, S., Webster, R.G. Molecular characterization of H9N2 influenza viruses: were they the donors of the "internal" genes of H5N1 viruses in Hong Kong ? Proc Natl
Acad Sci USA 96. 9363-9367, 1999. 17. Guo, Y.J., Li, J.W., Cheng, I. Discovery of humans infected by avian influenza A (H9N2) virus. Chin J Exp Clin Virol 15. 105-108, 1999. 70
18. Guo, Y.J., Krauss, S., Senne, D.A., Mo, I.P., Lo, K.S., Xiong, X.P., Norwood,
M.,
Shortridge,
K.F.,
Webster,
R.G.,
Guan,
Y.
Characterization of the pathogenicity of members of the newly established H9N2 influenza virus lineages in Asia. Virology 267. 279-288, 2000. 19. Hinshaw, V.S., Bean, W.J., Webster, R.G., and Sriram, G. Genetic reassortment of influenza A viruses in the intestinal tract of ducks. Virology 102. 412-419, 1980. 20. Hinshaw, V.S., Webster, R.G., Easterday, B.C., Bean, W.J. Replication of avian influenza A viruses in mammals. Infect
Immun 34. 354-361, 1981. 21. Hinshaw, V.S., Webster, R.G., Rodriguez, R.J. Influenza A viruses: combinations of hemagglutinin and neuraminidase subtypes isolated from animals and other sources. Brief review. Arch Virol 62. 281-290, 1979. 22. Hinshaw, V.S., Webster, R.G., Bean, W.J., Sriram, G. The ecology of influenza viruses in ducks and analysis of influenza viruses with monoclonal antibodies. Comp Immunol Microbiol Infect Dis 3. 155-164, 1980. 23. Hoffmann, E., Stech, J., Leneva, I., Krauss, S., Scholtissek, C., Chin,
P.S.,
Peiris,
M.,
Shortridge,
K.F.,
Webster,
R.G.
Characterization of the influenza A virus gene pool in avian species in southern China: was H6N1 a derivative or a precursor of H5N1? J Virol 74. 6309-6315, 2000. 24. Horimoto, T., Kawaoka, Y. Pandemic threat posed by avian influenza A viruses. Clin Microbiol Rev 14. 129-149, 2001. 25. http://www.agnr.umd.edu/avianflu/#Anchor-Etiology-11481 71
26. http://www.cdc.gov/flu/avian/outbreaks/index.htm 27. Jin, M., Wang, G., Zhang, R., Zhao, S., Li, H., Tan, Y., Chen, H. Development of enzyme-linked immunosorbent assay with nucleoprotein as antigen for detection of antibodies to avian influenza virus. Avian Dis 48. 870-878, 2004. 28. Kida, H., Ito, T., Yasuda, J., Shimizu, Y., Itakura, C., Shortridge, K. F., Kawaoka, Y., Webster, R.G. Potential for transmission of avian influenza viruses to pigs. J Gen Virol 75. 2183-2188, 1994. 29. Kilbourne, E.D. Influenza. Med Sci 13. 527-540, 1963. 30. Lamb, R. Genes and proteins of the influenza viruses. New York
Plenum Press. 1-67, 1989. 31. Lee, M.S., Chang, P.C., Shien, J.H., Cheng, M.C., Shieh, H.K. Identification and subtyping of avian influenza viruses by reverse transcription-PCR. J Virol Methods 97.13-22, 2001. 32. Li, K.S., Xu, K.M., Peiris, J.S., Poon, L.L., Yu, K.Z., Yuen, K.Y., Shortridge, K.F., Webster, R.G., Guan, Y. Characterization of H9 subtype influenza viruses from the ducks of southern China: a candidate for the next influenza pandemic in humans? J Virol 77. 6988-6994, 2003. 33. Lin, Y.P., Shaw, M., Gregory, V., Cameron, K., Lim, W., Klimov, A., Subbarao, K., Guan, Y., Krauss, S., Shortridge, K., Webster, R., Cox, N., Hay, A. Avian-to-human transmission of H9N2 subtype influenza A viruses: relationship between H9N2 and H5N1 human isolates. Proc Natl Acad Sci USA 97. 9654-9658, 2000. 34. Lonsdale, R., Pau, M.G., Oerlemans, M., Ophorst, C., Vooys, A., Havenga, M., Goudsmit, J., UytdeHaag, F., Marzio, G.A. Rapid method for immunotitration of influenza viruses using flow 72
35. Makarova, N.V., Ozaki, H., Kida, H., Webster, R.G., Perez, D.R. Replication and transmission of influenza viruses in Japanese quail. Virology 310. 8-15, 2003. 36. McGeoch, D., Fellner, P., Newton, C. Influenza virus genome consists of eight distinct RNA species. Proc Natl Acad Sci USA 73. 3045-3049, 1976. 37. Merchant, G.L., Mower, W.R., Talan, D.A. Update on emerging infections from the Center for Disease Control and Prevention. Influenza: ED Considerations for the 1997-98 season. Ann
Emerg Med 30. 692-694, 1997. 38. Naeem, K., Ullah , A., Manvell, R.J., Alexander, D.J. Avian influenza A subtype H9N2 in poultry in Pakistan. Vet Rec 145. 560, 1999. 39. Nicholson, K.G., Wood, J.M., Zambon, M. Influenza. Lancet 362. 1733-1745, 2003. 40. Ozaki, H., Sugiura T., Sugita S., Imagawa H., Kida H. Detection of antibodies to the nonstructural protein (NS1) of influenza A virus allows distinction between vaccinated and infected horses. Vet
Microbiol 82. 111-119, 2001. 41. Peiris, M., Yuen, K.Y., Leung, C.W., Chan, K.H., Lai, R.W., Orr, W.K., Shortridge, K.F. Human infection with influenza H9N2.
Lancet 354. 916-917, 1999. 42. Perez, D.R., Lim, W., Seiler, J.P., Yi, G., Peiris, M., Shortridge, K.F., Webster, R.G. Role of quail in the interspecies transmission of H9 influenza A viruses: molecular changes on HA that correspond to adaptation from ducks to chickens. J Virol 77. 73
3148-3156, 2003. 43. Perez,
D.R.,
Webby,
R.J.,
Hoffmann,
E.,
Webster,
R.G.
Land-based birds as potential disseminators of avian mammalian reassortant influenza A viruses. Avian Dis 47. 1114-1117, 2003. 44. Pinto, L.H., Holsinger, L.J., Lamb, R.A. Influenza virus M2 protein has ion channel activity. Cell 69. 517-528, 1992. 45. Poddar, S.K. Influenza virus types and subtypes detection by single
step
polymerase
single chain
tube
multiplex
reaction
reverse
(RT-PCR)
transcription-
and
agarose
gel
electrophoresis. J Virol Methods 99. 63-70, 2002. 46. Portela, A., Digard, P. The influenza virus nucleoprotein: a multifunctional RNA-binding protein pivotal to virus replication. J
Gen Virol 83. 723-734, 2002. 47. Profeta, M.L., Palladino, G. Serological evidence of human infections with avian influenza viruses. Arch Virol 90. 355-360, 1986. 48. Rohm, C., Zhou, N., Suss, J., Mackenzie, J., Webster, R.G. Characterization of a novel influenza hemagglutinin, H15: criteria for determination of influenza A subtypes. Virology 15. 508-516, 1996. 49. Rowe, T., Abernathy, R.A,. Hu-Primmer, J., Thompson, W.W., Lu, X., Lim, W., Fukuda, K., Cox, N.J., Katz, J.M. Detection of antibody to avian influenza A (H5N1) virus in human serum by using a combination of serologic assays. J Clin Microbiol 37. 937-943, 1999. 50. Schafer, J.R., Kawaoka, Y., Bean, W.J., Suss, J., Senne, D., Webster, R.G. Origin of the pandemic 1957 H2 influenza A virus 74
and the persistence of its possible progenitors in the avian reservoir. Virology 194. 781-788, 1993. 51. Shafer, A.L., Katz, J.B., Eernisse, K.A. Development and validation of a competitive enzyme-linked immunosorbent assay for detection of type A influenza antibodies in avian sera. Avian
Dis 42. 38-34, 1998. 52. Shortridge, K.F. Poultry and the influenza H5N1 outbreak in Hong Kong, 1997: abridged chronology and virus isolation. Vaccine
Suppl 1. 26-29, 1999. 53. Shortridge, K.F., Webster, R.G., Butterfield, W.K., Campbell, C.H. Persistence of Hong Kong influenza virus variants in pigs.
Science 196. 1454-1455, 1977. 54. Shortridge, K.F., Zhou, N.N., Guan, Y., Gao, P., Ito, T., Kawaoka, Y., Kodihalli, S., Krauss, S., Markwell, D., Murti, K.G., Norwood, M.,
Senne,
D.,
Sims,
L.,
Takada,
A.,
Webster,
R.G.
Characterization of avian H5N1 influenza viruses from poultry in Hong Kong. Virology 252. 331-342, 1998. 55. Slemons, R.D., Easterday, B.C. Type-A influenza viruses in the feces of migratory waterfowl. J Am Vet Med Assoc 171. 947-948, 1977. 56. Slemons, R.D., Easterday, B.C. Virus replication in the digestive tract of ducks exposed by aerosol to type-A influenza. Avian Dis 22. 367-377, 1978. 57. Sugiura, T., Sugita, S., Imagawa, H., Kanaya, T., Ishiyama, S., Saeki, N., Uchiyama, A., Tanigawa, M., Kuwano, A. Serological diagnosis of equine influenza using the hemagglutinin protein produced in a baculovirus expression system. J Virol Methods 98. 75
58. Sugrue, R.J., Hay, A.J. Structural characteristics of the M2 protein of influenza A viruses: evidence that it forms a tetrameric channel. Virology 180. 617-624, 1991. 59. Tumpey, T.M., Alvarez, R., Swayne, D.E., Suarez, D.L. Diagnostic approach for differentiating infected from vaccinated poultry on the basis of antibodies to NS1, the nonstructural protein of influenza A virus. J Clin Microbiol 43. 676-683, 2005. 60. Webby, R.J., Webster, R.G. Emergence of influenza A viruses.
Philos Trans R Soc Lond B Biol Sci 356. 1817-1828, 2001. 61. Webster, R.G., Yakhno, M., Hinshaw, V.S., Bean, W.J., Murti, K.G. Intestinal influenza: replication and characterization of influenza viruses in ducks. Virology 84. 268-278, 1978. 62. Webster,
R.G.,
Shortridge,
K.F.,
Kawaoka,
Y.,
Influenza:
interspecies transmission and emergence of new pandemics.
FEMS Immunol Med Microbiol 18. 275-279, 1997. 63. Wharton, S.A., Weis, W., Skehel, J.J., Wiley, D.C. Structure, function, and antigenicity of the hemagglutinin of influenza virus. in the influenza viruses. New York Plenum Press. 153-174, 1989. 64. Yang, D.K., Kweon, C.H., Kim, B.H., Lim, S.I., Kwon, J.H., Kim, S.H., Song, J.Y., Han, H.R. Immunogenicity of baculovirus expressed recombinant proteins of Japanese encephalitis virus in mice. J Vet Sci 6. 125-133, 2005. 65. Zebedee, S.L., Lamb, R.A. Influenza A virus M2 protein: monoclonal antibody restriction of virus growth and detection of M2 in virions. J Virol 62. 2762-2772, 1988. 76
ACKNOWLEDGMENTS My dear parents not only raised me with love but also taught me how to be an independent, successful, and good person. I am here to express my deeply gratitude to them. I would like to give thanks to my elder brothers and sister who have always given me fully mental and material life. I would especially like to express my thanks and gratitude to Professor Kang, Shien-Young of the Department of Veterinary Medicine, Graduate School, Chungbuk National University, south of Korea, for his invaluable academic supervision, financial supports, and cares during my study in Korea. It is obvious that I would not have been able to follow out my ambition without his supports and invaluable academic guidance. My special thanks are given to all Professors of the Department of Veterinary Medicine, Graduate School, Chungbuk National University who have given me useful lectures, suggestions, and advices. Especially, many thanks are directed to Professor Lee, Wan-Kyu for his agreement to act as the thesis examiner. I would like to take this opportunity to express my deeply acknowledgments to Professor Mo, In-Pil of the Department of Veterinary Medicine, Graduate School, Chungbuk National University who has helped and supported me all the experiment samples as well as scientific discussions. My best appreciations and sincere thanks are given to Mr. 77
Yong-Hwan Lim, Mr. Seung-Chul Lee, Miss. Ji-Hye Jeong, Miss. Su-Kyung Kim, Miss. Hang-Bok Cheon, Miss. Eun-Young Kim who have helped and given me a pleasant and wonderful working atmosphere during the period of time in Korea which positively influenced on my life and work in Korea. The last but not the least, I would like to express my infinite gratitude to Associate Professor Truong Van Dung-Director of National Institute of Veterinary Research-Vietnam, to Dr To Long Thanh-Vice Director of National Center for Veterinary DiagnosisVietnam who have always given me the best advices and assistances during my scientific work in Vietnam and Korea. Above people are very remarkable and significant for me. I could never be what I am today without them. Their contributions constitute a debt that I may never hope to repay.
LE VAN PHAN
78
