Molecular Ecology Notes (2005) 5, 917–919

doi: 10.1111/j.1471-8286.2005.01112.x

PRIMER NOTE

Blackwell Publishing, Ltd.

Development of polymorphic markers for Cirsium arvense, Canada thistle, and their amplification in closely related taxa T R A C E Y A . B O D O S L O T T A , M I C H A E L E . F O L E Y and D A V I D H O R V A T H USDA-ARS-BRL, PO Box 5674 Univ Sta, Fargo, ND 58102 USA

Abstract Suppression of invasive Canada thistle, Cirsium arvense, with biological control agents has stalled because introduced agents were not host-specific. To aid in the development of more effective management strategies, molecular markers are needed to examine the genetic structure of Canada thistle populations. Microsatellite (simple sequence repeat) markers were developed and intersimple sequence repeat (ISSR) markers were tested for North American populations. An average of nine polymorphic alleles per microsatellite locus and 11 per ISSR locus were detected. These will be used to examine the genetic structure of C. arvense in the northern Great Plains and their transferability to endemic Cirsium spp. Keywords: Cirsium, intersimple sequence repeats, microsatellites Received 1 April 2005; revision accepted 15 June 2005

Cirsium arvense L. (Asteraceae), Canada thistle, a native to Eurasia, infests over 12 million acres in the United States spreading 10–12% each year (Carrithers et al. 2005). Canada thistle is a dioecious perennial weed, which colonizes through sexual and asexual (extensive root system) reproduction. Biological control efforts have focused on the release of weevils (Larinus and Rhinocyllis) to limit the growth of populations. However, there have been concerns of nontarget effects, as weevils have been found on North American endemic thistles (Louda & O’Brien 2002). Research on the population dynamics of C. arvense and on the relationships of thistles in the northern Great Plains is needed as a first step in finding and developing more effective management strategies, such as host-specific biological control agents. In surveying genetic diversity with molecular markers, the centre of origin can be inferred and then studied for biological control agents, the genetic distance of native to introduced thistles can be assessed, and the diversity present in local populations can be identified. Here, we describe the development of microsatellite (simple sequence repeat) and utility of intersimple sequence repeat (ISSR) markers for C. arvense and their transferability to other Cirsium spp.

Correspondence: T. A. Bodo Slotta, Fax: 701-239 1252; E-mail: [email protected] © 2005 Blackwell Publishing Ltd

Genomic DNA was extracted from mature leaf tissue of thistles using the DNEasy kit (QIAGEN). Individuals in populations from nine states were included; three representatives from one population were pooled for SSR development by Genetic Identification Services. Genomic DNA was digested to completion with HindIII (New England Biolabs). Fragments ranging from 350 to 700 bp were used to create libraries enriched for four microsatellite motifs (CAn, TACAn, TAGAn and ATGn). The fragments were ligated into the HindIII cut site of the pUC19 plasmid (Fermentas) and transformed into competent Escherichia coli strain DH5α cells (Invitrogen). Colonies were grown overnight on LB agar plates containing ampicillin (100 mg/L), Xgal and Bluo-gal. Recombinant colonies were screened by polymerase chain reaction (PCR) amplification in 10 µL reactions with M-13 primers (forward: 5′-AGGAAACAGCTATGACCATG-3′; reverse: 5′-ACGACGTTGTAAAACGACGG-3′) and an annealing temperature of 58 °C. Once recombinant clones were identified, an overnight culture was grown and plasmid DNA purified using Millipore MultiScreen MADB NOB (Millipore). DNA sequencing was accomplished using DYEnamic ET Terminator Cycle Sequencing Kit (Amersham Biosciences), followed by electrophoresis on an Applied Biosystems model 377 DNA Sequencer. In the 100 sequenced clones, 51 different microsatellitecontaining clones were obtained. Primers for 31 clones

918 P R I M E R N O T E Table 1 Characterization of ISSR and SSR loci in Cirsium arvense

Locus Repeat motif ISSR CA8 807 899 Hans CAT4 CAC5 SSR C11

(CA)8 (AG) 8 (CA)6 (AC)7 (CAT)4 (CAC)5 (TATG)4-TG-(TATG)4-TA-(TATG)3

C101

(TACA)9

C120

(TATG)8

C128

(TATG)7(TA)7

D101

(TAGA)9

Primer sequence (5′−3′) (CA)8-RG (AG)8-TG (CA)6 RG (AC)7-RG GT-(CAT)4 (CAC)5-AG F: AATTGGGACTGCTATGTTCG R: CTTATTTGTCCTCACGTCACA F: GGCACAAATTAGTGAGGTTTT R: CCGACCATGATAGACGATC F: CCACGAGTTTCTACCCTTTG R: CCACTTTACTTTCCCACCTG F: ATGTTCCTACACACACACACAT R: TGCTGTTACAAAGTTTTAGTCG F: GTTGCTCTATTTTAACCAGGTG R: GGATACCATTATGCGAATCTAG

Amplification No. of size range (bp) alleles

D

HE

HO

GenBank

700–1120 700–1090 500–1500 320–1445 475–1400 825–1250 180–650

13 9 15 15 12 5 9

0.3151 0.3116 0.3436 0.3537 0.2471 0.0478 0.2683

0.6969 0.5309 0.6909 0.6625 0.8070 0.8874 0.7997

0.6784 0.5294 0.6294 0.6324 0.7789 0.8628 0.7765

* * * * * * AY971680

210–450

10

0.2664 0.8145 0.8009 AY971681

110–400

17

0.2500 0.8094 0.7834 AY971682

190–260

8

0.2276 0.8455 0.7831 AY971683

150–220

4

0.1091 0.9248 0.8742 AY971684

Nei’s genetic diversity (D) recovered, expected (HE) and observed (HO) heterozygosities and GenBank Accession nos are provided. No sequences were generated and submitted to GenBank for the ISSR regions (*).

were designed using designerpcr version 1.03 (Research Genetics, Inc.). Primer pairs were tested in 10 µL reactions consisting of 1× BioTaq buffer, 1× sucrose/Cresol Red (20% sucrose with 10 mm Cresol Red), 1.5 –2 mm MgCl2, 0.2 mm each dNTP, 0.6 µm each primer, 0.25 U BioTaq and 0.2 ng/µL template. Cycle parameters were as follows: 94 °C 3 min, 35 cycles at 94 °C 40 s, 45 – 60 °C 40 s, 72 °C 30 s, and a final extension of 72 °C for 4 min. Of the 31 primer pairs tested in six individuals from populations across North America, 28 successfully amplified, 13 were consistent. An additional five primer pairs from Jump et al. (2002) were tested (Caca 01, 05, 07, 10 and 17). Amplification products were separated by electrophoresis in nondenaturing, 3% acrylamide gels. Sizes of products were estimated by quantity one version 4.1.1 (Bio-Rad Laboratories) in comparison to a 25 bp ladder (Invitrogen). Of 18 SSR primers screened, five were found to be polymorphic in C. arvense populations in North Dakota, Minnesota (Table 1). Primers based on Jump et al. (2002) were not polymorphic within the ND/MN populations, but did show variability across a larger distribution of populations (Virginia to North Dakota). The C11 and C120 loci were optimized at 1.5 mm MgCl2 and C101 and C128 at 2 mm MgCl2. The annealing temperatures for each primer were optimized at: C11 (45 °C), C101 and C120 (55 °C) and C128 (60 °C). Since a limited number of polymorphisms were detected among the designed SSR primers, intersimple sequence repeat (ISSR) markers were selected as an alternative strategy in assessing genetic diversity in Cirsium. In contrast to SSR markers, ISSR primers are not taxa-specific and are designed to be embedded in the repeated regions. ISSR

markers have been used in numerous studies as a costefficient (polymorphisms per dollar) method to assess genetic diversity of horticultural varieties and in natural populations (Wolfe et al. 1998). A string of di-, tri- or tetraucleotide repeats, usually with an anchoring tag on either the 5′ or 3′ end to prevent slip-strand artefacts, are used as primers. Primer sequences were selected and amplification protocols for ISSR markers followed Wolfe et al. (1998). Products were separated by electrophoresis in 1.5% agarose. Amplification products were scored as the presence or absence of alleles and analysed. Of 17 ISSR primers screened, six were found to be polymorphic in C. arvense populations in North Dakota, Minnesota (Table 1). Analysis of allelic frequencies was calculated from 59 individuals representing two populations in North Dakota, one in Fargo, the other near Medora. Expected and observed heterozygosities, and Nei’s diversity index were calculated in popgene (Yeh et al. 1999). Linkage disequilibrium, deviation from Hardy–Weinberg equilibrium, and genetic diversity within C. arvense populations were calculated (Table 2). The level of diversity detected by the two marker types is comparable. The developed SSR and ISSR markers are being used to investigate the genetic structure of additional populations of C. arvense across the northern Great Plains. Primer sets (SSR and ISSR) with polymorphic loci in C. arvense were also used in amplifications of five to eight individuals from two populations of other Cirsium spp.: C. flodmanii, C. undulatum and C. vulgare. Primers successfully amplified markers for all of the species. Alleles for each marker were observed in each of the species (Table 2). © 2005 Blackwell Publishing Ltd, Molecular Ecology Notes, 5, 917–919

P R I M E R N O T E 919 Table 2 Analyses of genetic markers in Cirsium arvense and other species No. of alleles amplified Primer

No. of alleles

χ2

P value

HW

GST

C. flodmanii

C. undulatum

C. vulgare

CA8 807 899 Hans CAT4 CAC5 C11 C101 C120 C128 D101

13 9 15 15 12 5 9 10 17 8 4

9.1282 10.887 8.9113 8.9086 11.1541 11.0073 9.6000 11.1631 11.8527 10.5641 18.2150

0.00420 0.00351 0.00450 0.00503 0.00314 0.00405 0.00443 0.00323 0.00244 0.00249 0.00120

3 5 3 6 6 0 2 3 7 5 1

0.08378 0.14511 0.07380 0.18147 0.31625 0.25896 0.09117 0.12335 0.13657 0.20176 0.14245

8 (4) 7 (1) 8 (6) 6 (3) 4 (2) 5 (5) 4 (2) 1 (0) 0 (0) 1 (0) 1 (0)

7 (5) 5 (1) 4 (2) 7 (2) 2 (0) 5 (3) 3 (0) 1 (0) 0 (0) 1 (0) 1 (0)

8 (0) 12 (3) 8 (2) 12 (0) 6 (0) 8 (1) 6 (0) 2 (0) 1 (0) 1 (0) 1 (0)

Linkage disequilibrium (χ2 and P value), the number of alleles with significant (P < 0.05) deviation from Hardy–Weinberg equilibrium (HW), mean genetic diversity among subpopulations (GST) for Cirsium arvense samples and the number of alleles amplified in other Cirsium species indicating the number possible polymorphisms in parentheses.

Homology of the C. arvense ISSR and SSR loci to the related species is being evaluated.

Acknowledgements Rodney Lym (NDSU) provided assistance in collecting plant material. J. Gaskin and R. Roehrdanz reviewed an earlier draft of the manuscript. Microsatellite loci developed by Genetic Identification Services, 9552 Topanga Canyon Blvd., Chatsworth, CA, USA.

References Carrithers VF, Duncan CL, Jachetta JJ et al. (2005) Invasive plants of range and wildlands and their environmental, economic and

© 2005 Blackwell Publishing Ltd, Molecular Ecology Notes, 5, 917–919

societal impacts. Weed Science Society of America Annual Meeting Feb 7–10, Honolulu, HI.: Abstract, 428. Jump A, Dawson DH, James CM, Woodward FI, Burke T (2002) Isolation of polymorphic microsatellites in the stemless thistle (Cirsium acaule) and their utility in other Cirsium species. Molecular Ecology Notes, 2, 589–592. Louda SM, O’Brien CW (2002) Unexpected ecological effects of distributing the exotic weevil, Larinus planus (F), for the biological control of Canada thistle. Conservation Biology, 16, 717–727. Wolfe AD, Xiang Q-Y, Kephart SR (1998) Assessing hybridization in natural populations of Pensetmon (Scrophulariaceae) using hypervariable inter-simple sequence repeat (ISSR) bands. Molecular Ecology, 7, 1107–1125. Yeh FC, Yang R-C, Boyle T (1999) POPGENE version 1.31. Microsoft Window-based freeware for population genetic analysis. Free program distributed by the authors. http://www.ualberta.ca/∼fyeh/