Environmental Microbiology (2008) 10(7), 1668–1680

doi:10.1111/j.1462-2920.2008.01583.x

Characterizing the regulation of the Pu promoter in Acinetobacter baylyi ADP1 Wei E. Huang,1*† Andrew C. Singer,1 Andrew J. Spiers,1 Gail M. Preston2 and Andrew S. Whiteley1** 1 Molecular Microbial Ecology, CEH-Oxford, Mansfield Road, Oxford OX1 3SR, UK. 2 Department of Plant Sciences, University of Oxford, South Parks Road, Oxford OX1 3RB, UK. Summary Effective gene trapping and screening requires sensory and regulatory compatibility of both host and exogenous systems. The naturally competent bacterium Acinetobacter baylyi ADP1 is able to efficiently take up and integrate exogenous DNA into the chromosome, making it an attractive host system for a wide range of metagenomic applications. To test the ability of A. baylyi ADP1 to express the XylRregulated Pu promoter from Pseudomonas putida mt-2, we have constructed and examined an A. baylyi ADP1 strain, ADPWH-Pu-lux-xylR. The Pu promoter in ADPWH-Pu-lux-xylR was specifically induced by toluene, m-, p- and o-xylene. The substrate-induced Pu promoter was highly dependent on the growth medium: it was repressed in rich media until stationary phase, but was immediately induced in minimal medium with glucose as the sole carbon source (MMG). However, the Pu promoter was repressed in MMG when it was supplemented with 5 g l-1 yeast extract. Further investigation showed that the Pu promoter in MMG was repressed by 0.5 g l-1 aspartic acid or asparagine, but not repressed by glutamine. Changing the carbon/nitrogen ratios by addition of ammonia did not significantly affect the Pu promoter activity but addition of nitrate did. These results show that A. baylyi ADP1 reproduced characteristics of the XylR-regulated Pu promoter observed in its original host. It demonstrates that A. baylyi could provide an excellent genetic host for a wide range of functional metagenomic applications. Received 29 September, 2007; accepted 26 January, 2008. For correspondence. *E-mail [email protected]; Tel. (+44) 114 2225796; Fax (+44) 114 2225701; or **E-mail [email protected]; Tel. (+44) 114 2225796; Fax (+44) 114 2225701. †Present address: Kroto Research Institute, University of Sheffield, Broad Lane, S3 7HQ, UK.

Introduction Metagenomics is a promising approach to address the challenge of recovering novel xenobiotic-degrading enzymes from unculturable microorganisms (Schloss and Handelsman, 2003; Handelsman, 2004). Functional metagenomics requires cloning DNA into a culturable organism for functional study (Uchiyama et al., 2005). One important metagenomic strategy is substrateinduced gene expression screening (SIGEX), which is based on the model that an inducible regulatory protein activates a promoter of an operon fused with a reporter gene, and that substrate-dependent induction can be used to identify DNA fragments that contain genes involved in catabolism of a specific substrate (Uchiyama et al., 2005). However, for SIGEX to be successful, it is critical that the surrogate host reproduces the same substrate-inducible gene regulation as the source bacterium. SIGEX has successfully been used to isolate metagenomic DNA fragments containing benzoate- and naphthalene-inducible promoters from contaminated groundwater, with Escherichia coli as a host. However, E. coli is not always an ideal host for gene regulation systems originating from other taxonomic groups. For example, E. coli cannot properly express DmpR, the phenol degradation regulatory protein from Pseudomonas sp. CF600 (Bernardo et al., 2006). Similarly, genes expressed in E. coli may not reproduce the regulatory characteristics observed in the source strain. For example, the Pu promoter of Pseudomonas putida mt-2 is significantly repressed in its natural genetic background during exponential growth, even in the presence of toluene or xylenes (Marques et al., 1994; Cases et al., 1996), while in E. coli the Pu promoter is immediately induced in response to inducing substrates, irrespective of growth phase (Abril et al., 1989; Willardson et al., 1998). Acinetobacter baylyi ADP1 (previously Acinetobacter sp. ADP1) is a nutritionally versatile chemo-heterotroph, occupying a wide range of habitats (water and soil) and lifestyles (Young et al., 2005). Analyses of the 16S rRNA gene and the A. baylyi ADP1 genome and proteome suggest that A. baylyi ADP1 is closely related to the order Pseudomonadales (Barbe et al., 2004; Young et al., 2005; Vaneechoutte et al., 2006). Acinetobacter baylyi ADP1 has many characteristics that make it an ideal genetic

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd

Characterizing the regulation of the Pu promoter 1669 host for a wide range of metagenomic applications. First, A. baylyi ADP1 is naturally competent and can take up either naked or plasmid DNA making it a suitable alternative to E. coli for genetic engineering (Palmen and Hellingwerf, 1997; Barbe et al., 2004; Metzgar et al., 2004). The DNA transformation efficiency of ADP1 can reach 10-2 (de Vries et al., 2003), which is more efficient than calcium chloride-treated E. coli (Palmen and Hellingwerf, 1997; Barbe et al., 2004; Metzgar et al., 2004). Second, A. baylyi ADP1 can easily perform multigene trappings which may overcome the in cis transcription limitation associated with single trapping in SIGEX. Third, A. baylyi ADP1 is able to express a wide range of heterologous genes (Kok et al., 1999; Melnikov and Youngman, 1999; Huang et al., 2005; Young et al., 2005), implying that the gene expression and protein folding in A. baylyi ADP1 may be highly robust. Finally, it is proposed that A. baylyi ADP1 should have similar regulation machinery to the bacteria present in natural water and soils, which makes it an ideal host to reconstruct complex regulatory processes involving complex regulators and signal chemicals. In this study, we cloned the RpoN (s54)-dependent Pu–XylR regulatory system into the chromosome of A. baylyi ADP1, as a foundation for future studies involving multigene cloning and acclimatization of exogenous DNA. For this purpose, we have fused the Pu promoter with a bioluminescence reporter operon luxCDABE. The corresponding regulatory gene xylR from the TOL plasmid of P. putida mt-2 was inserted into an adjacent location in the chromosome. We examined the effects of inducers, carbon sources and amino acids on activation of the Pu promoter. We confirmed that the Pu promoter–XylR regulatory system not only functioned in A. baylyi ADP1, but also reproduced the expression characteristics observed in its original host – P. putida mt-2. We also revealed that the repression of the Pu promoter can be caused by aspartic acid or asparagine, but not glutamine, although all these three amino acids are involved in bacterial nitrogen metabolism. Our results support the proposition that A. baylyi ADP1 could be a useful alternative host for functional metagenomics.

Results and discussion Construction of A. baylyi ADPWH-Pu-lux-xylR To investigate the behaviour of the Pu promoter–XylR regulatory system in A. baylyi ADP1, we constructed a bioluminescence reporter mutant strain, ADPWH-Pu-luxxylR, in which luxCDABE was fused with the Pu promoter and regulated by XylR expressed in trans. First, Pu-luxCDABE (6163 bp) was inserted into the salAR operon of the salA mutant A. baylyi ADPW67

(Jones et al., 2000) by homologous recombination of plasmid pSalAR_Pu_lux to generate A. baylyi ADPWHPu-lux (Fig. 1). Plasmid pSalAR_Pu_lux contains fragments of the salA and salR genes cloned either side of Pu-luxCDABE, and is derived from pGEM-T [Promega, UK (Huang et al., 2005)], which belongs to a family of cloning vectors that have been shown not to replicate in strain A. baylyi ADP1 (Young and Ornston, 2001). Recombination of pSalAR_Pu_lux with the mutated salA gene of A. baylyi ADPW67 results in replacement of the disrupted salA gene with a functional gene, and transformants could be identified on the basis of their ability to grow on 2.5 mM salicylate as sole carbon source (SAA). The frequency of the gene transformation was 6.1 ⫾ 0.7 ¥ 10-6. Polymerase chain reaction (PCR) amplification and DNA sequencing using the primer pairs salA_flank_for and luxC_rev, and salAR_rev and luxE_fwd (Fig. 1 and Table 2), confirmed the presence of the Pu promoter and luxCDABE cassette in the chromosome of ADPWHPu-lux (Fig. 1). We have previously shown that the salA promoter is strong enough to transcribe large inserts between salA and salR (Huang et al., 2005), and this was confirmed here as ADPWH-Pu-lux was able to grow on salicylate agar (SAA; data not shown) and displayed salicylate-induced bioluminescence, indicating that salA and salR were functional and expressed (Figs S1A and S2A). Second, xylR-Km was inserted into the salA gene of ADPWH-Pu-lux to create A. baylyi ADPWH-Pu-lux-xylR by using plasmid pSalA_Km_xylR as a donor and ADPWH-Pu-lux as a recipient (Fig. 1). Plasmid pSalA_ Km_xylR contains a xylR-terminator-Km cassette flanked by two homologous fragments of salA (Fig. 1). The transformants were selected on Luria–Bertani (LB) agar with 10 mg ml-1 kanamycin. The transformation frequency was 7.7 ⫾ 0.3 ¥ 10-6. The insertion of the xylR-terminator-Km cassette completely prevented read-through from the salA promoter, and A. baylyi ADPWH-Pu-lux-xylR displayed no expression of luxCDABE in the presence of salicylate (Fig. S2B). Unlike the eukaryotic luc reporter (Willardson et al., 1998), the bacterial reporter operon luxCDABE provides self-sufficient bioluminescence expression without addition of the substrate (e.g. luciferin) for the reaction. The luxCDABE reporter acts as a more sensitive reporter of gene expression than lacZ in A. baylyi ADP1, and permits detection of gene expression over a wider range, which allows the unambiguous detection of promoter activity (Siehler et al., 2007). Pu expression in A. baylyi ADPWH-Pu-lux-xylR is induced by toluene and xylene Exposure of ADPWH-Pu-lux-xylR colonies grown on LB agar plates to toluene, m-, p- or o-xylene vapours

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680

1670 W. E. Huang et al.

Fig. 1. Outline of construction of the A. baylyi ADPWH-Pu-lux-xylR bioluminescence reporter. ADPWH-Pu-lux was produced by integrating the suicide plasmid pSalAR_Pu_lux containing Pu promoter-luxCDABE flanked on either side by salA and partial salR sequences, into ADPW67 and replacement of the kanamycin (Km) resistance cassette in salA. The resulting Km-sensitive strain ADPWH-Pu-lux can grow on SAA plates as it now contains an uninterrupted copy of salA. The suicide plasmid pSalA_Km_xylR containing a Km resistance gene, terminator and xylR gene flanked on either side of partial salA (salA1 and salA2), was then integrated into ADPWH_Pu_lux to give the Km-resistant strain ADPWH-Pu-lux-xylR. The terminator sequence was included between the xylR and Km genes to prevent transcriptional read-through of luxCDABE from the salA promoter without activation of the Pu promoter. The correct insertion of each of these chromosomal cassettes was confirmed by colony-PCR and sequencing. DNA length is not shown to scale.

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680

Characterizing the regulation of the Pu promoter 1671 ity and sensitivity, ADPWH-Pu-lux-xylR could be a useful soil and rhizosphere-based biosensor for toluene and xylene.

Relative bioluminescence

100000 m-xylene p-xylene o-xylene toluene

10000

Pu promoter activation in A. baylyi ADPWH-Pu-lux-xylR is growth medium dependent

1000

100

10 0

0.5 5 50 Inducer concentration (µM)

500

Fig. 2. Sensitivity of A. baylyi ADPWH_Pu_lux_xylR to toluene and xylenes (P < 0.05). Bioluminescence was measured at OD600 = 0.8 in LB medium. The error bars represent standard error for three bioluminescence readings from three replicate samples.

(generated by placing a filter tip dipped in substrate on the agar plate) resulted in strong bioluminescence while un-induced colonies remained dark (Fig. S1B). However, no bioluminescence was observed after exposure to phenol, benzene, naphthalene, sodium salicylate (sodium 2-hydroxybenzoate), 3-hydroxybenzate, 4-hydroxybenzate, benzoate or catechol (data not shown), which indicates that the Pu promoter–XylR regulatory system in A. baylyi ADPWH-Pu-lux-xylR specifically responds to toluene and xylenes, as observed in P. putida mt-2. These results provide further evidence that salicylate dependent expression of luxCDABE was blocked by introduction of the xylR-terminator-Km construct, and confirm that the xylR-terminator-Km construct did not prevent toluene/ xylenes dependent expression of the luxCDABE cassette. ADPWH-Pu-lux, which does not contain xylR in the chromosome, cannot be induced by toluene or xylene (Fig. S2), which confirms that induction of lux expression in ADPWH-Pu-lux-xylR is mediated by XylR, rather than a native xylR-like regulator. This is supported by BLASTP and Pfam domain analyses of the genome sequence of A. baylyi ADP1, which show that this strain does not contain any regulatory proteins that display significant similarity to XylR. ADPWH-Pu-lux-xylR is not only highly specific but also highly sensitive, capable of detecting toluene or xylenes as low as 0.5 mM in liquid cultures grown to late log phase (Fig. 2). The bioluminescence became stronger as toluene/xylene concentration increased within the range 0.5–500 mM (Fig. 2), showing that ADPWH-Pu-lux-xylR can be used to quantify XylR-dependent regulation of Pu promoter expression. Acinetobacter ADPWH-Pu-lux-xylR cannot metabolize toluene and toluene more or less has inhibit effect on cells growth. Because of its high specific-

The Pu promoter–XylR regulatory system is RpoN (s54) dependent (Cases and de Lorenzo, 2005). The results described above confirm that the RpoN (s54) protein of A. baylyi ADP1 can substitute for the function of the P. putida RpoN and allows the XylR and the Pu promoter to function well in ADPWH-Pu-lux-xylR, in a similar way to its original host P. putida. XylR and growth mediumdependent regulation of the Pu promoter in Pseudomonas has been well documented (Marques et al., 1994; Cases et al., 1996) (for review, please see Cases and de Lorenzo, 2005), so experiments were performed to test whether growth medium-dependent regulation of Pu expression in ADPWH-Pu-lux-xylR was also similar to regulation in P. putida. As in its original host P. putida mt-2, the XylR-regulated Pu promoter in A. baylyi ADPWH-Pu-lux-xylR was repressed during exponential growth phase when bacteria were grown in rich medium such as LB, in spite of the presence of toluene or xylenes, and induced in stationary phase (Fig. 3A). This phenomenon is classically referred to as ‘exponential silencing’ (Cases et al., 1996). However, the Pu promoter in A. baylyi ADPWH-Pu-lux-xylR was immediately activated regardless of growth phase when bacteria were grown in minimal medium-glucose (MMG) in the presence of toluene or xylene (Fig. 3B), which is in good agreement with observations of Pu-dependent mRNA expression in P. putida (Marques et al., 1994). Interestingly, addition of 5 g l-1 yeast extract to MMG medium repressed the Pu promoter in ADPWH-Pu-lux-xylR during the first 7 h of growth (Fig. 4). Collectively, these experiments show that the activation of Pu promoter in A. baylyi ADPWH-Pu-luxxylR can be affected by the growth medium. The Pu promoter’s immediate activation in minimal medium but significant delay in the presence of yeast extract suggests the repression of Pu promoter could be related to some chemicals in yeast extract. Aspartic acid and asparagine but not glutamine represses Pu promoter activity in ADPWH-Pu-lux-xylR Rich media such as LB and MMG supplemented with yeast extract contain more complex chemical compounds than minimal medium such as MMG, including high concentrations of amino acids. Therefore, the delay of Pu promoter activation in LB and MMG with yeast extract may be associated with global regulatory mechanisms linked to amino acid metabolism, as proposed by Marques and colleagues (1994). As the Pu promoter is

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680

1672 W. E. Huang et al. 20000

2

A1

LB 1.6

Relative Bioluminescence

16000

LB+toluene

18000

1.2

16000

0.8

Relative Bioluminescence

OD600

18000

14000 0.4

12000

0 0

10000

2

10

20 Time (h)

30

8000 6000

LB-Biolum

LB LB+m-xylene

1.6 OD600

20000

1.2 0.8 0.4

14000

0 0

12000

10 20 Time (h)

30

10000 8000 LB-Biolum

6000

LB+m-xylene-Biolum

LB+toluene-Biolum

4000

4000

2000

2000

0

0 0

5

10

15

20

25

30

0

5

10

20000

B1

MM+glu MM+glu+toluene

2

15

20

B2

20000 18000

1.2

16000

0.8

Relative Bioluminescence

0.4

14000

0 0

12000

OD600

OD600

16000

10 20 Time (h)

30

10000 8000 6000 4000

MM+glu MM+glu+m-xylene

2

MM+glu-Biolum

0

0.8

0

14000

0

10 20 Time (h)

30

12000 10000 8000 6000

MM+glu-Biolum MM+glu+m-xylene-Biolum

2000

MM+glu+toluene-Biolum

1.2

0.4

4000

2000

30

1.6

1.6

18000

25

Time (h)

Time (h)

Relative Bioluminescence

A2

0 0

5

10

15 Time (h)

20

25

30

0

5

10

15 Time (h)

20

25

30

Fig. 3. Pu promoter activity in A. baylyi ADPWH-Pu-lux-xylR is dependent on the growth media (P < 0.05). In LB (rich medium), the Pu promoter was only induced after 10–15 h even in the presence of toluene (A1), m-xylene (A2), p-xylene (A3) or o-xylene (A4). However, in MMG (minimal medium), Pu promoter was induced immediately in the presence of toluene (B1), m-xylene (B2), p-xylene (B3) or o-xylene (B4). MM, minimal medium.

RpoN (s54) dependent and rpoN expression is known to be repressed by high nitrogen availability in P. putida (Cases and de Lorenzo, 2005), three amino acids: aspartic acid, asparagine and glutamine, which are associated with bacterial nitrogen metabolism, were tested for their effects on Pu promoter repression. Minimal mediumglucose was supplemented with 0.5 g l-1 aspartic acid, asparagine or glutamine, which is equivalent to the

estimated individual amino acid concentration in yeast extract. The addition of aspartic acid (3.76 mM) or asparagine (3.78 mM) to MMG fully repressed the Pu promoter for 23 h, the period of observation (Fig. 4). In contrast, the addition of glutamine (3.42 mM) to MMG immediately activated and enhanced Pu promoter activity (Fig. 4). However, despite these differences, ADPWH-Pu-lux-xylR displayed similar growth characteristics in MMG supple-

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680

Characterizing the regulation of the Pu promoter 1673 LB LB+o-xylene

2

1.6

14000

A3

LB

16000

0.8

0.4 0

14000

0.4

0

10

12000

0 0

10000

A4

1.2 0.8

1.2

12000

1.6

18000

LB+p-xylene

Relative Bioluminescence

Relative bioluminescence

16000

20000

OD600

2

18000 OD600

20000

10 20 Time (h)

30

LB-Biolum

8000 LB-Biolum

6000

LB+o-xylene-Biolum

LB+p-xylene-Biolum

4000

4000

2000

2000

0

0 0

5

10

15

20

25

30

0

5

10

Time (h) MM+glu MM+glu+p-xylene

2

20000

1.6

16000

0.8 0.4 0

14000

0

12000

10 20 Time (h)

B4

18000

B3

1.2

Relative Bioluminescence

OD600

18000

30

10000 8000 6000

15 Time (h)

16000

20

25

30

MM+glu MM+glu+o-xylene

2 OD600

20000

Relative Bioluminescence

30

10000

8000 6000

20 Time (h)

1.6 1.2 0.8 0.4

14000

0 0

10 20 Time (h)

12000

30

10000 8000 6000 4000

4000 MM+glu-Biolum

2000

MM+glu-Biolum MM+glu+o-xylene-Biolum

2000

MM+glu+p-xylene

0

0 0

5

10

15

20

25

Time (h)

30

0

5

10

15 Time (h)

20

25

30

Fig. 3. cont.

mented with glutamine, aspartic acid or asparagine (Fig. 4). Cell densities in MMG supplemented with amino acids were twice higher than in MMG-only medium, indicating that ADPWH-Pu-lux-xylR could use glutamine, aspartic acid and asparagine as nitrogen and carbon sources. This shows that the Pu promoter can be repressed or induced in response to the presence and metabolism of a single, specific amino acid, as suggested for the Pu promoter–XylR regulatory system in P. putida (Marques et al., 1994). Glutamine is an important metabolite in bacterial physiology (Forchhammer, 2007) and an indicator of

nitrogen status (Arcondeguy et al., 2001). The main pathway for glutamine assimilation in Acinetobacter is likely to involve conversion of glutamine to glutamate and then to the TCA cycle intermediate oxoglutarate. In contrast, asparagine is converted to aspartate and then to fumarate, the TCA cycle intermediate immediately downstream of succinate. All three amino acids can be used to generate energy via the TCA cycle, but only glutamine metabolism also acts to signal high nitrogen status, which could help to explain why asparagine and aspartate both act as repressors of Pu expression, but glutamine does not.

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680

1674 W. E. Huang et al. MM+Glu MM+Glu+YE+m-xylene MM+Glu+Aspartic acid+m-xylene MM+Glu+Asparagine+m-xylene MM+Glu+Glutamine+m-xylene

MM+Glu MM+Glu+YE+m-xylene 2

MM+Glu+Aspartic acid+m-xylene MM+Glu+Asparagine+m-xylene 60000

1.6

OD600

MM+Glu+Glutamine+m-xylene

1.2 0.8

50000

Relative bioluminescence

0.4 0

40000

10

0

20

30

Time (h)

Fig. 4. Regulation of Pu promoter activity by single amino acids (P < 0.05). Acinetobacter baylyi ADPWH-Pu-lux-xylR was incubated in MMG (30 mM glucose as sole carbon source), and MMG supplemented with either 5 g l-1 yeast extract (YE), 0.5 g l-1 aspartic acid, 0.5 g l-1 asparagine or 0.5 g l-1 glutamine. m-xylene was added to all media at a final concentration of 500 mM as an inducing substrate. Bacteria grew at similar rates in media supplemented with YE or amino acids (inset). The Pu promoter was immediately induced and expressed at an increased level in MMG-glutamine, but expression was delayed 7 h in YE. Pu promoter activity was significantly inhibited in MMG-aspartate and MMG-asparagine. MM, minimal medium.

30000

20000

10000

0 0

5

10

15

20

25

30

Time (h)

When multiple carbon sources are available, bacteria preferentially use economically favourable substrates (Holtel et al., 1994). Bacteria achieve this regulation through carbon catabolite repression (CCR) (Stulke and Hillen, 1999). In the presence of preferred carbon sources (typically glucose), bacteria will repress the machinery needed for the assimilation of other less labile carbon sources (Holtel et al., 1994; Ramos et al., 1997; Stulke and Hillen, 1999; Bruckner and Titgemeyer, 2002). Carbon catabolite repression by glucose and succinate has been reported to limit Pu promoter activity in both E. coli and P. putida (Holtel et al., 1994; Duetz et al., 1996). In the presence of 500 mM toluene, m-, por o-xylene, ADPWH-Pu-lux-xylR both MMS (minimal medium with 30 mM succinate) and LB gave similar levels of Pu expression, but glucose did not repress Pu activity but enhanced it. Pu activity in MMG was two- to fourfold higher than in MMS and LB media (Fig. 5). This indicates that succinate, but not glucose, exerts carbon catabolite repression on Pu–xylR expression in ADPWHPu-lux-xylR, and is in good agreement with Dal and Gerischer’s observations (Dal et al., 2002; Siehler et al., 2007). The phosphotransferase (PTS) system protein PstN (IIANtr) is required for glucose repression of Pu promoter

activity in P. putida (Cases et al., 1999). Acinetobacter baylyi ADP1 lacks a glucose PTS system and oxidizes glucose to gluconate in the periplasm (Barbe et al., 2004; Young et al., 2005), and this characteristic of glucose 20000 18000 Relative bioluminescence

Carbon source effect on Pu activity of ADPWH_Pu_lux_xylR

16000 14000

Succinate Glucose LB

12000 10000 8000 6000 4000 2000 0 control

T500

M500

P500

O500

Treatments Fig. 5. The effect of glucose and succinate on Pu promoter activity in A. baylyi ADPWH-Pu-lux-xylR (P < 0.05). Pu activity is expressed as a function of relative bioluminescence. Pu activity in LB, glucose (30 mM) or succinate (30 mM) minimal medium in the presence of 500 mM of toluene (T500), m-xylene (M500), p-xylene (P500) or o-xylene (O500). Controls were media without inducer. Bioluminescence was measured at OD600 = 0.8.

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680

Characterizing the regulation of the Pu promoter 1675 assimilation might explain the lack of glucose-induced catabolite repression in ADPWH-Pu-lux-xylR. Velazquez and colleagues (2004) have proposed that the Entner– Doudoroff catabolites 6-phosphogluconate (6-PG) and 2-dehydro-3-deoxyphosphogluconate (KDPG) are signal molecules for Pu promoter repression in P. putida. Acinetobacter baylyi ADP1 lacks both a G6P dehydrogenase and 6-phosphogluconolactonase required to produce these catabolites from G6P (Barbe et al., 2004). ADPWHPu-lux-xylR was found to be able to grow on 6-PG as the sole carbon source; it indicates 6-PG can be transported into the cells as carbon source. However, the addition of 6-PG ranging from 0.1 to 300 mM in LB media had no effect on Pu promoter activity (data not shown). It suggests that KDPG instead of 6-PG should be a repression signal of Pu promoter activity in Acinetobacter baylyi ADP1, which is in good agreement with the observation of the XylR-regulated Pu promoter in P. putida KT2440 host by del Castillo (del Castillo and Ramos, 2007). The effect of carbon/nitrogen ratio on Pu promoter activity Carbon metabolism is controlled by carbon-derived signals and the availability of nitrogen and other nutrients (Commichau et al., 2006). We examined Pu promoter activity in MMG supplemented with varying concentrations of ammonia or nitrate, and containing m-xylene as an inducing substrate. Expression of the Pu promoter increased in media with a high carbon/nitrogen ratio with nitrate as a nitrogen source, but showed no significant change in media with ammonia as a nitrogen source (Fig. 6). XylR activates Pu expression by activating the alternate sigma factor RpoN, which also regulates genes involved in nitrogen assimilation. In P. putida, rpoN expression is modulated by nitrogen availability (Cases and de Lorenzo, 2005), so it is possible that nitrogen modulates Pu expression as a result of the effect of nitrogen on the activity and expression of RpoN. In conclusion, this study has shown that the substrate, nutrient and growth-dependent properties of the Pu promoter–XylR system can be reconstituted in a surrogate host, A. baylyi ADP1, which accurately mimics the regulatory and physiological characteristics of bacterial species commonly found in natural habitats such as soils and groundwater. Acinetobacter baylyi ADP1 is likely to provide a better genetic host than E. coli, at least in this case, for functional metagenomic approaches such as SIGEX, as E. coli can show non-specific compound induction and non-characteristic regulation (Willardson et al., 1998), particularly when expressing plasmid-borne genes. The chromosomal integration strategy described in this study can easily be adapted to screen libraries of DNA fragments containing putative regulator–promoter

pairs in the presence and absence of inducing substrates, thereby isolating novel degradative and regulatory genes from both culturable and unculturable bacteria. Experimental procedures Bacterial strains and media The bacterial strains and plasmids used in this study are listed in Table 1. Acinetobacter baylyi ADP1 and its mutants were incubated at 28°C or 30°C, and E. coli at 37°C. All chemicals were obtained from Sigma-Aldrich and were analytical grade reagents. Luria–Bertani medium or minimal medium (Huang et al., 2005) was used for the cultivation of bacteria as appropriate. Minimal medium-glucose and MMS were prepared by the addition of 30 mM glucose or succinate to minimal medium. Salicylate agar was prepared using 2.5 mM salicylate as a sole carbon source in minimal medium with 1.4% Noble agar (Marine BioProduct, Canada). Amino acidsupplemented media were prepared by adding 5 g l-1 yeast extract (YE), 0.5 g l-1 aspartic acid, 0.5 g l-1 asparagine or 0.5 g l-1 glutamine to MMG. Benzene, benzoates, catechol, naphthalene, phenol, toluene, m-xylene, p-xylene, o-xylene, 2-hydroxybenzoic acid (salicylic acid), 3-hyroxybenzoic and 4-hydroxybenzoic were also added to plates or cultures for induction or growth tests. Ampicillin (Amp) at 100 mg ml-1 and 50 mg ml-1 kanamycin (Km) was used for E. coli, and 10 mg ml-1 Km for A. baylyi ADP1 or its mutants when required. Gene transformation Preparation of competent A. baylyi ADP1 cells was performed as described previously (Palmen et al., 1993; Huang et al., 2005). Briefly, ADPW67 or ADP1_Pu_lux was grown in 5 ml of LB at 30°C with shaking at 200 r.p.m. overnight. Two hundred microlitres of culture was then diluted into 5 ml of fresh LB medium and incubated for 2 h to make the cells competent. Cells were harvested by 3000 r.p.m. centrifugation and re-suspended in 0.5 ml of fresh LB. Two micrograms of intact plasmid DNA was added to the 0.5 ml competent cells (109 cells ml-1) and incubated for 2 h at 30°C. The cells were then plated on selective media to obtain the appropriate transformants. Molecular techniques materials Escherichia coli JM109 (Promega, UK) was used for plasmid cloning and preparation according to the manufacturer’s instructions. All oligonucleotide primers were obtained from MWG Biotech (http://www.mwg-biotech. com/) and are listed in Table 2. QIAquick gel extraction kit (Qiagen, UK) was used to purify DNA from agarose

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680

1676 W. E. Huang et al.

A. NH4+ C/N=1 C/N=4 C/N=6 C/N=8 C/N=10

2

18000

C/N=1 C/N=4

1.6

C/N=6

1.2

OD600

20000

C/N=8

16000

0.8

Relative Bioluminescence

C/N=10 0.4

14000

0 0

12000

10

Time (h)

20

30

10000 8000

Fig. 6. The effect of carbon/nitrogen (C/N) ratio on Pu promoter activity in A. baylyi ADPWH-Pu-lux-xylR. A. Varying the carbon/nitrogen ratio by providing ammonia as sole nitrogen source and varying ammonia concentration has no significant effect on Pu activity in A. baylyi ADPWH-Pu-lux-xylR (P > 0.1). B. Varying the carbon/nitrogen ratio by providing nitrate as sole nitrogen source and varying nitrate concentration has a significant effect on Pu activity (P < 0.05). Higher carbon/nitrogen ratio induced stronger Pu activity; lower carbon/nitrogen ratio led to reduced Pu activity. In both (A) and (B), varying the carbon/ nitrogen ratio had little effect on cell growth (inset) (P > 0.05).

6000 4000 2000 0 0

5

10

15 Time (h)

20

25

30

B. NO3C/N=1 C/N=4 C/N=6 C/N=8 C/N=10

2

C/N=1 C/N=4 C/N=6 C/N=8

18000

1.6 OD600

20000

1.2 0.8

C/N=10

16000

0.4

Relative Bioluminescence

0 0

14000

10

20

30

Time (h)

12000 10000 8000 6000 4000 2000 0 0

5

10

15 Time (h)

20

25

30

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680

Characterizing the regulation of the Pu promoter 1677 Table 1. Strains and plasmids used in this study. Bacteria and plasmids

Description

Reference

Acinetobacter baylyi strains ADP1(BD413) Wild type ADPW67 SalA::Kmr, Km gene inserted into ClaI site of salA ADPWH-Pu-lux 320 bp Pu promoter and luxCDABE (~5.8 kb) gene inserted into an EcoRI site created between salA and salR, obtained by transformation of ADPW67 and pSalAR_lux ADPWH-Pu-lux-xylR xylR gene inserted into an EcoRI site created in salA, obtained by transformation of ADP1_pu_lux6 and pSalA_xylR_Km Escherichia coli strains JM109 High-efficiency competent cells Plasmids pGEM-T Ampr, T7 and SP6 promoters, lacZ, vector pRMJ2 Source plasmid for Km gene (1654 bp) pSB417 luxCDABE source plasmid, luxCDABE from Photorhabdus (Xenorhabdus) luminescens ATCC2999 (Hb strain) pMC2 Source of Pu promoter pTS174 Source of xylR and its native promoter pSalAR_lux luxCDABE (5846 bp) gene from pSB417 by EcoRI and inserted into an EcoRI site created between salA and salR of pSalAR_BE pSalAR_ Pu_ lux Pu promoter inserted into the EcoRI site of pSalAR_lux pSalA_BE SalA (1791 bp) gene cloned into pGEM-T, with EcoRI and BamHI restriction sites created by overlap extension PCR pSalAR_Km Km gene (1654 bp) gene from pRMJ2 inserted between the EcoRI and BamHI sites of pSalA_BE pSalA_Km_xylR xylR with its native promoter from pxylR inserted into the EcoRI site of pSalA_Km

gels for cloning or sequencing as the manufacturer’s instructions. Plasmid construction and chromosomal insertions were confirmed by PCR and DNA sequencing. Polymerase chain reaction was carried out using a Sigma PCR kit. For colony-PCR, single-colony material re-suspended in 50 ml of PCR reaction mixture was used as DNA template material. Plasmid construction Constructing pSalAR_Pu_lux. The 320 bp Pu promoter fragment was excised from pMC2 by EcoRI and ligated with partially EcoRI-digested pSalAR_lux (Huang et al., 2005) (Fig. 1). Escherichia coli JM109 competent cells (Promega, UK) were transformed with the ligation mixture, and then spread on LB Amp for selection. Sixteen colonies were investigated by colony-PCR (Sigma PCR kit) using primers salA_end_for and luxC_rev (Table 2), with

Juni and Janik (1969) Jones et al. (2000) This study

This study

Promega Promega Jones and Williams (2003) Winson et al. (1998) Inouye et al. (1983) Inouye et al. (1983) Huang et al. (2005) This study This study This study This study

an initial denaturation at 95°C for 5 min, followed by 35 cycles of 94°C for 1 min, 58°C for 1 min and 72°C for 1 min, and a final extension at 72°C for 10 min. After amplification, 10 ml of PCR product was examined by agarose-ethidium bromide gel electrophoresis. The PCR fragments from four clones were purified from the gel (QIAquick gel extraction kit, Qiagen) and confirmed by DNA sequencing. A clone containing a plasmid in which the Pu promoter sequence was in the same orientation as luxCDABE was selected and designated as pSalAR_Pu_ lux (Fig. 1). Constructing pSalA_Km_xylR • Overlap extension PCR to create restriction cut sites. EcoRI and BamHI restriction sites were created within the salA gene by overlap extension PCR (OEP) as previously described (Huang et al., 2005). Two salA fragments,

Table 2. Oligonucleotide primers used in this study. Primers

Sequence (5′ → 3′)

Note

salA_flank_for salA_EB_for salA_EB_rev salA_revH luxC_rev salAR_rev luxE_for xylR1_for xylR_rev

CCAGCTGATCAGTTGTAGAATG GATGCTATTTTAGGGAGAATTCCACGGATCCAGTGTAAGT ACTTACACTGGATCCGTGGAATTCTCCCTAAAATAGCATC AACAGGTTGTATTGCTGCTCGC GAGAGTCATTCAATATTGGCAGG GACCTGAGTATGCCCGGTAG TGGTTTACCAGTAGCGGCACG TGGATTTCAGTTAATCAATTGGT CTATCGGCCCATTGCTTTCAC

Outside salA gene Created EcoRI and BamHI sites Created EcoRI and BamHI sites The site between salA and salR Internal to luxC gene Internal to salA and salR Internal to luxE gene Forward flanking xylR Reverse flanking xylR

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680

1678 W. E. Huang et al. salA1 (907 bp) and salA2 (924 bp), were separately amplified by PCR using a colony of ADP1 as DNA template and the primer pairs salA_flank_for–salA_BE_ rev and salA_BE_fwd–salA_revH (Table 2). Polymerase chain reaction amplifications were performed with an initial denaturation at 95°C for 5 min, followed by 35 cycles of 94°C for 1 min, 58°C for 1 min and 72°C for 1 min, and a final extension at 72°C for 10 min. The PCR products were isolated from an agarose gel using QIAquick gel extraction kit (Qiagen, UK). To fuse the two salA fragments, a PCR amplification (using the same reaction conditions as above, except an extension time at 72°C for 2 min) was carried out using 1 ml of diluted (1:100) salA1 and salA2 fragments as DNA templates and primers salA_flank_for and salA_revH (Table 2). The resultant PCR product of the OEP salA fragment contains EcoRI and BamHI restriction sites. It was isolated from an agarose gel (QIAquick gel extraction kit, Qiagen) and then cloned into pGEM-T (Promega) to give pSalA_BE (Fig. 1). • Construction of pSalA_Km_xylR. The kanamycin gene (1472 bp) was excised from pRMJ2 (Jones and Williams, 2003) by EcoRI and BamHI and ligated into EcoRI– BamHI-digested pSalA_BE to create pSalA_Km (Fig. 1). The xylR gene fragment (2399 bp) was excised from pTS174 by EcoRI and ligated into EcoRI-digested pSalA_Km to create pSalA_Km_xylR (Fig. 1). ColonyPCR and sequencing was performed to confirm that xylR had been correctly inserted using primer pairs xylR1_for and xylR_rev (Table 2). The PCR condition was: initial denaturation at 95°C for 5 min, followed by 35 cycles of 94°C for 1 min, 50°C for 1 min and 72°C for 2 min, and a final extension at 72°C for 10 min. Construction of ADP1 mutants The construction of ADPWH-Pu-lux-xylR is outlined in Fig. 1. pSalAR_pu_lux was integrated into A. baylyi ADPW67 by homologous recombination and selection on SAA to give ADPWH-Pu-lux. Acinetobacter baylyi ADPW67 has a kanamycin gene inserted into the salA gene and cannot grow on SAA plates with salicylate as a sole carbon source. The integration of pSalAR_pu_lux by double-cross-over homologous recombination replaced the disrupted salA gene with a functional copy of the gene and therefore enabled the transformants ADPWH-Pu-lux to grow on SAA. To confirm the presence of the Pu promoter and luxCDABE cassette, colony-PCR reactions were performed using the primer pairs salA_flank_for and luxC_rev, and salAR_rev and luxE_fwd (Table 2), and the PCR products were sequenced. pSalA_Km_xylR was similarly integrated into ADPWHPu-lux, with selection for Km resistance to give ADPWH-

Pu-lux-xylR. The presence of xylR was confirmed by colony-PCR using the primer pair xylR1_for and xylR_rev (Table 2). Failure to grow on SAA was used to confirm homologous recombination of ADPWH-Pu-lux-xylR. Nucleotide sequencing and sequence analysis All DNA samples (PCR products or plasmids) were sequenced using dye terminator sequencing on an Applied Biosystems 3730 DNA analyser. DNA sequences were aligned and edited using BioEdit (Tom Hall, Department of Microbiology, North Carolina State University) to confirm correct insertions. The plasmid pSalAR_Km_xylR has been fully sequenced and submitted to the National Center for Biotechnology Information (NCBI) and the accession number is DQ202262. Acinetobacter baylyi ADPWH_Pu_lux and ADPWH_Pu_lux_xylR induction All experiments were carried out in triplicate and bioluminescence assay was measured in triplicate, and means ⫾ standard error are presented. The T-test was performed using Excel (Microsoft Software) for statistical analysis. Pu promoter activity was monitored by measuring relative bioluminescence (bioluminescence divided by OD600). For each measurement, at each time point 100 ml of samples were analysed in triplicate in clear-bottomed black 96-well optical microplates (Nalge Nunc International, USA). OD600 and bioluminescence were measured using a Synergy HT Multi-Detection Microplate Reader (Bio-Tek, UK). Different inducers. A single colony of A. baylyi ADPWH_Pu_lux_xylR was inoculated in 5 ml of LB liquid medium placed in a 30 ml glass universal tube, and incubated at 28°C overnight. The cells were re-inoculated into a fresh medium after a 1:25 dilution. Inducers were preadded into media as appropriate. Toluene, p-, o- or m-xylenes, phenol, benzene, naphthalene, 2-hydroxybenzoic (salicylic acid), 3-hyroxybenzoic, 4-hydroxybenzoic, benzoate or catechol were separately added into LB as inducer, respectively, with final concentration of 500 mM. Samples were incubated at 28°C with shaking at 150 r. p.m. OD600 and bioluminescence were measured over a period up to 27 h. Induction on solid media. Bacteria were incubated on LB agar plates with inducers at 28°C. For salicylate assays salicylate was added to LB agar to a final concentration of 2.5 mM. For toluene and xylene assays toluene or xylene vapour was used to induce the XylR-regulated Pu promoter. Three microlitres of toluene or xylene was loaded into a filtered tip, which was placed onto LB agar.

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680

Characterizing the regulation of the Pu promoter 1679 Bioluminescent plates were imaged in the dark using a Versa-Doc Imaging System (Bio-Rad Laboratories, Herts, UK). Images were captured using the ‘high sensitive chemiluminescent’ setting for 30 s with a Nikon 50 mm lens at f1.4. Carbon and nitrogen source effects. Acinetobacter sp. ADPWH_Pu_lux_xylR was inoculated into MMG, MMS and LB to compare the effect of carbon source on Pu activity. Ammonia chloride, sodium nitrate and glucose were added into nitrogen-free minimal medium (MMN, minimal medium without ammonium chloride) to make media with carbon/nitrogen ratios of 1, 4, 6, 8 and 10. The inducers toluene, p-, o- and m-xylene were separately added to a final concentration of 500 mM. Cultures were incubated at 28°C with 150 r.p.m. shaking. Acknowledgements We thank Professor Peter Williams of University of Wales, Bangor, for providing A. baylyi ADPW67.

References Abril, M.A., Michan, C., Timmis, K.N., and Ramos, J.L. (1989) Regulator and enzyme specificities of the Tol plasmidencoded upper pathway for degradation of aromatichydrocarbons and expansion of the substrate range of the pathway. J Bacteriol 171: 6782–6790. Arcondeguy, T., Jack, R., and Merrick, M. (2001) P-II signal transduction proteins, pivotal players in microbial nitrogen control. Microbiol Mol Biol Rev 65: 80–105. Barbe, V., Vallenet, D., Fonknechten, N., Kreimeyer, A., Oztas, S., Labarre, L., et al. (2004) Unique features revealed by the genome sequence of Acinetobacter sp. ADP1, a versatile and naturally transformation competent bacterium. Nucleic Acids Res 32: 5766–5779. Bernardo, L.M.D., Johansson, L.U.M., Solera, D., Skarfstad, E., and Shingler, V. (2006) The guanosine tetraphosphate (ppGpp) alarmone, DksA and promoter affinity for RNA polymerase in regulation of sigma(54)-dependent transcription. Mol Microbiol 60: 749–764. Bruckner, R., and Titgemeyer, F. (2002) Carbon catabolite repression in bacteria: choice of the carbon source and autoregulatory limitation of sugar utilization. FEMS Microbiol Lett 209: 141–148. Cases, I., and de Lorenzo, V. (2005) Promoters in the environment: transcriptional regulation in its natural context. Nat Rev Microbiol 3: 105–118. Cases, I., deLorenzo, V., and PerezMartin, J. (1996) Involvement of sigma(54) in exponential silencing of the Pseudomonas putida TOL plasmid Pu promoter. Mol Microbiol 19: 7–17. Cases, I., Perez-Martin, J., and de Lorenzo, V. (1999) The IIA(Ntr) (PtsN) protein of Pseudomonas putida mediates the C source inhibition of the sigma(54)-dependent Pu promoter of the TOL plasmid. J Biol Chem 274: 15562– 15568.

del Castillo, T., and Ramos, J.L. (2007) Simultaneous catabolite repression between glucose and toluene metabolism in Pseudomonas putida is channeled through different signaling pathways. J Bacteriol 189: 6602–6610. Commichau, F.M., Forchhammer, K., and Stulke, J. (2006) Regulatory links between carbon and nitrogen metabolism. Curr Opin Microbiol 9: 167–172. Dal, S., Steiner, I., and Gerischer, U. (2002) Multiple operons connected with catabolism of aromatic compounds in Acinetobacter sp. strain ADP1 are under carbon catabolite repression. J Mol Microbiol Biotechnol 4: 389–404. Duetz, W.A., Marques, S., Wind, B., Ramos, J.L., and vanAndel, J.G. (1996) Catabolite repression of the toluene degradation pathway in Pseudomonas putida harboring pWWO under various conditions of nutrient limitation in chemostat culture. Appl Environ Microbiol 62: 601–606. Forchhammer, K. (2007) Glutamine signalling in bacteria. Front Biosci 12: 358–370. Handelsman, J. (2004) Metagenomics: application of genomics to uncultured microorganisms. Microbiol Mol Biol Rev 68: 669–684. Holtel, A., Marques, S., Mohler, I., Jakubzik, U., and Timmis, K.N. (1994) Carbon source-dependent inhibition of Xyl operon expression of the Pseudomonas-Putida Tol plasmid. J Bacteriol 176: 1773–1776. Huang, W.E., Wang, H., Huang, L.F., Zheng, H.J., Singer, A.C., Thompson, I.P., and Whiteley, A.S. (2005) Chromosomally located gene fusions constructed in Acinetobacter sp. ADP1 for the environmental detection of salicylate. Environ Microbiol 7: 1339–1348. Inouye, S., Nakazawa, A., and Nakazawa, T. (1983) Molecular-cloning of regulatory gene XylR and operatorpromoter regions of the XylABC and XylDEGF operons of the Tol plasmid. J Bacteriol 155: 1192–1199. Jones, R.M., and Williams, P.A. (2003) Mutational analysis of the critical bases involved in activation of the AreRregulated sigma(54)-dependent promoter in Acinetobacter sp. strain ADP1. Appl Environ Microbiol 69: 5627–5635. Jones, R.M., Pagmantidis, V., and Williams, P.A. (2000) sal genes determining the catabolism of salicylate esters are part of a supraoperonic cluster of catabolic genes in Acinetobacter sp. strain ADP1. J Bacteriol 182: 2018–2025. Juni, E., and Janik, A. (1969) Transformation of Acinetobacter calcoaceticus (Bacterium anitratum). J Bacteriol 98: 281–288. Kok, R.G., Young, D.M., and Ornston, L.N. (1999) Phenotypic expression of PCR-generated random mutations in a Pseudomonas putida gene after its introduction into an Acinetobacter chromosome by natural transformation. Appl Environ Microbiol 65: 1675–1680. Marques, S., Holtel, A., Timmis, K.N., and Ramos, J.L. (1994) Transcriptional induction kinetics from the promoters of the catabolic pathways of Tol plasmid Pww0 of Pseudomonas putida for metabolism of aromatics. J Bacteriol 176: 2517– 2524. Melnikov, A., and Youngman, P.J. (1999) Random mutagenesis by recombinational capture of PCR products in Bacillus subtilis and Acinetobacter calcoaceticus. Nucleic Acids Res 27: 1056–1062. Metzgar, D., Bacher, J.M., Pezo, V., Reader, J., Doring, V., Schimmel, P., et al. (2004) Acinetobacter sp. ADP1: an

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680

1680 W. E. Huang et al. ideal model organism for genetic analysis and genome engineering. Nucleic Acids Res 32: 5780–5790. Palmen, R., and Hellingwerf, K.J. (1997) Uptake and processing of DNA by Acinetobacter calcoaceticus – a review. Gene 192: 179–190. Palmen, R., Vosman, B., Buijsman, P., Breek, C.K.D., and Hellingwerf, K.J. (1993) Physiological characterization of natural transformation in Acinetobacter calcoaceticus. J Gen Microbiol 139: 295–305. Ramos, J.L., Marques, S., and Timmis, K.N. (1997) Transcriptional control of the Pseudomonas tol plasmid catabolic operons is achieved through an interplay of host factors and plasmid-encoded regulators. Annu Rev Microbiol 51: 341–373. Schloss, P.D., and Handelsman, J. (2003) Biotechnological prospects from metagenomics. Curr Opin Biotechnol 14: 303–310. Siehler, S.Y., Dal, S., Fischer, R., Patz, P., and Gerischer, U. (2007) Multiple-level regulation of genes for protocatechuate degradation in Acinetobacter baylyi includes cross-regulation. Appl Environ Microbiol 73: 232–242. Stulke, J., and Hillen, W. (1999) Carbon catabolite repression in bacteria. Curr Opin Microbiol 2: 195–201. Uchiyama, T., Abe, T., Ikemura, T., and Watanabe, K. (2005) Substrate-induced gene-expression screening of environmental metagenome libraries for isolation of catabolic genes. Nat Biotechnol 23: 88–93. Vaneechoutte, M., Young, D.M., Ornston, L.N., De Baere, T., Nemec, A., Van Der Reijden, T., et al. (2006) Naturally transformable Acinetobacter sp. strain ADP1 belongs to the newly described species Acinetobacter baylyi. Appl Environ Microbiol 72: 932–936. Velazquez, F., di Bartolo, I., and de Lorenzo, V. (2004) Genetic evidence that catabolites of the Entner–Doudoroff pathway signal C source repression of the sigma(54) Pu promoter of Pseudomonas putida. J Bacteriol 186: 8267– 8275. de Vries, J., Heine, M., Harms, K., and Wackernagel, W. (2003) Spread of recombinant DNA by roots and pollen of transgenic potato plants, identified by highly specific biomonitoring using natural transformation of an Acinetobacter sp. Appl Environ Microbiol 69: 4455–4462. Willardson, B.M., Wilkins, J.F., Rand, T.A., Schupp, J.M., Hill, K.K., Keim, P., and Jackson, P.J. (1998) Development and testing of a bacterial biosensor for toluene-based environmental contaminants. Appl Environ Microbiol 64: 1006– 1012. Winson, M.K., Swift, S., Hill, P.J., Sims, C.M., Griesmayr, G.,

Bycroft, B.W., et al. (1998) Engineering the luxCDABE genes from Photorhabdus luminescens to provide a bioluminescent reporter for constitutive and promoter probe plasmids and mini-Tn5 constructs. FEMS Microbiol Lett 163: 193–202. Young, D.M., and Ornston, L.N. (2001) Functions of the mismatch repair gene mutS from Acinetobacter sp. strain ADP1. J Bacteriol 183: 6822–6831. Young, D.M., Parke, D., and Ornston, L.N. (2005) Opportunities for genetic investigation afforded by Acinetobacter baylyi, a nutritionally versatile bacterial species that is highly competent for natural transformation. Annu Rev Microbiol 59: 519–551.

Supplementary material The following supplementary material is available for this article online: Fig. S1. Induction of Pu expression by chemicals. A. Bioluminescence produced by A. baylyi ADPWH-Pu-lux colonies when not induced (A1); induced by 500 mM salicylate (A2) or by toluene vapour (A3). B. Bioluminescence produced by A. baylyi ADPWH-Pu-luxxylR colonies when not induced (B1), induced with toluene (B2), m- (B3), o- (B4) or p-xylene (B5) vapours. Bacteria were grown on LB agar and incubated for 20 h at 28°C in the presence of vapour before imaging. Vapours were produced by placing 3 ml of inducer into a filtered tip in each Petri dish. The top panel shows plates imaged using visible light, and the bottom panels show bioluminescence produced by colonies on the same plates imaged in the dark. Fig. S2. Bioluminescence of A. baylyi ADPWH-Pu-lux was induced by salicylate (500 mM) but not by m-xylene (500 mM). P < 0.05. Biolum in the figure represents bioluminescence. Acinetobacter baylyi ADPWH-Pu-lux immediately expressed bioluminescence in LB medium with 500 mM salicylate but did not respond to m-xylene (500 mM), which rules out the presence of endogenous Pu-activating regulatory proteins in ADP1. This material is available as part of the online article from http://www.blackwell-synergy.com Please note: Blackwell Publishing are not responsible for the content or functionality of any supplementary materials supplied by the authors. Any queries (other than missing material) should be directed to the correspondence for the article.

© 2008 The Authors Journal compilation © 2008 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 10, 1668–1680