Molecular Ecology Notes (2006) 6, 706– 708

doi: 10.1111/j.1471-8286.2006.01317.x

PRIMER NOTE Blackwell Publishing Ltd

Characterization of microsatellite markers for the tanoak tree, Lithocarpus densiflorus V E R O N I C A R . F . M O R R I S and R I C H A R D S . D O D D Department of Environmental Science, Policy and Management, University of California, Berkeley, California 94720, USA

Abstract We describe the development of 19 primers for amplification of microsatellite loci for tanoak, Lithocarpus densiflorus (Hook. & Arn.). A population from Soquel State Demonstration Forest, Santa Cruz County, California (n = 20), and eight individuals from four additional coastal populations and one interior (Sierra Nevada) population were used to investigate polymorphism. The total number of alleles per locus ranged from two to 10. Observed heterozygosity in the Soquel population ranged from 0.05 to 0.70, with two loci being fixed. Keywords: California, Lithocarpus, microsatellite, tanoak Received 14 October 2005; revision accepted 8 January 2006

Coastal woodlands of northern California and southern Oregon are suffering heavy mortality from infection by Phytophthora ramorum, which causes sudden oak death (McPherson et al. 2005). Tanoak, Lithocarpus densiflorus (Hook. & Arn.), is a common component of these coastal woodlands and is also found in interior woodlands of the Sierra Nevada in California. This species is unusual in that infection occurs in foliage as well as in the main stem where cankers are produced. Recently, heavy losses of tanoak have become a major concern to natural resource managers in this region of the Pacific coast of North America. Tanoak is able to reproduce vegetatively as well as by seed, but no data are available on the population genetic structure of this species and how different modes of reproduction may affect spatial distribution of genotypes. Population genetic studies are lacking in tanoak, but these are important in beginning to understand host–pathogen interactions at the host-population level. To date, there have been no microsatellite markers derived specifically for use on L. densiflorus, but they will be a particularly valuable tool for assessing population genetic diversity and relatedness among individuals of this species. Mature L. densiflorus leaves were obtained from Soquel State Demonstration Forest, Santa Cruz County, California. Genomic DNA was extracted using a simplified cetyltrimethyl ammonium bromide (CTAB) method (Cullings

Correspondence: Veronica R. F. Morris, Fax: (510) 643-5438; E-mail: [email protected]

1992). This DNA was used to build a microsatellite-enriched library by following a modified Glen & Schable (2005) protocol. Four micrograms of extracted DNA was restricted with RsaI (New England Biolabs) and ligated to doublestranded SuperSNX-24 linkers (forward 5′-GTTTAAGGCCTAGCTAGCAGAATC-3′, reverse 5′-GATTCTGCTAGCTAGGCCTTAAACAAAA-3′). The restriction–ligation reaction was hybridized to mixtures of the following single-stranded biotinylated oligonucleotide probes: (CA)13 (GA)15 (AT)4 (AAT)12 (CAA)9 (AACC)5 (AACG)5 (AAGC)5 (AAGG)8 (ATCC)5 (AAAC)6 (AAAG)6 (AATC)6 (AATG)6 (ACCT)6 (ACAG)6 (ACTC)6 (ACTG)6 (AAAT)8 (AACT)8 (AAGT)8 (ACAT)8 (AGAT)8. Magnetic beads coated with streptavidin (Dyna1) were used to capture hybridized DNA, while unhybridized DNA was discarded. The enrichment procedure was then repeated. Polymerase chain reaction (PCR) was used to recover enriched DNA, and 4 µL was cloned with a TOPO TA kit (Invitrogen). XL1-Blue (QIAGEN) chemically competent Escherichia coli was transformed with PCR II-TOPO TA cloning vectors ligated to enriched DNA per the manufacturer’s instructions. We screened for successful transformation using the β-galactosidase gene and amplified the inserts from positive colonies using M13 primers. Two hundred and twenty-four fragments (500– 1000 bp long) were sequenced with M13 forward and reverse primers using BigDye version 3.1 (Applied Biosystems) on an ABI 3100 automated sequencer. We designed primers for 87 sequences that were positive for microsatellite repeats and were appropriate for primer design of flanking regions. Primers were designed manually © 2006 The Authors Journal compilation © 2006 Blackwell Publishing Ltd

© 2006 The Authors Journal compilation © 2006 Blackwell Publishing Ltd

Table 1 Primer sequences designed to amplify microsatellite loci in Lithocarpus densiflorus and their characterization in the native range of the species GenBank Accession no.

Ld1

DQ272386

Ld2

DQ272387

Ld3

DQ272388

Ld4

DQ272389

Ld5

DQ272390

Ld6

DQ272391

Ld7

DQ272392

Ld8

DQ272393

Ld9

DQ272394

Ld10

DQ272395

Ld11

DQ272396

Ld12

DQ272397

Ld13

DQ272398

Ld14

DQ272399

Ld15

DQ272400

Ld16

DQ272401

Ld17

DQ272402

Ld18

DQ272403

Ld19

DQ272404

Sequence 5′−3′

Repeat sequence

Allele range (bp)*

F: CTGATGAAGAGGAAGCCGAAG† R: GTGGCCCTTTCTGACATGG F: GGCACATAGAGTTAAACCC‡ R: GGCCCACCAAAATGCTATCTC F: GCTAAAATTGGTGACTATG‡ R: GGTTTACTAGAGCTCCAAAGG F: GCCGGTCAATATAATTTGTTGC† R: GAGTAGGGTAGGGCTGATC F: TGCTCCGAACCCATGTA‡ R: GAAATCGTTTCTTTGGGGTGTG F: CTAGAGAGTCAGGGTAAGCACC‡ R: CAGAAAAGAAATGAAGATGCTG F: ACCACACGAATGCAGCACAATCAC‡ R: GAATACCTCCTGTCCCACGTGAC F: GTATCGGCGGCTTCGGTGGTC† R: CAAATAGCCACGTTGCAACAC F: GGCAAGAGATCCTGATGCATGTG† R: CAGAATCAATCTGCAATCTC F: GAGACAAGAATGAGCATCTC R: GTGATTGCATGTCTAGCTG† F: CTGTTGGGTATGGTTGTCACTC‡ R: CCTTAATTATGAGGAAAAAAC F: CATCATCAAAACTACCGAC‡ R: CGGTATCGATCTTGGAACAAC F: GATTCGCAATACGATTCACG‡ R: CGCATATGTATTTTCGTGGGAG F: GTCCAGGCTGCAGGCAATAG‡ R: ATTGCCCTTGCCATTG F: GCAGCACACAATGCAATTTCC‡ R: GTTCCATCAACTATTGACTCTG F: CCTTCATTTCACATAATAGTGAATC‡ R: GGAGTTGCCACCTGATTATAGG F: CACAAGTTTATTCAATTTATTGG‡ R: CAAGACCATTAGAGCACC F: GTTTGGCTTTGGCGCCACCTTCAC† R: GGAGTGACTTCGAGGTCGTTTGG F: GAATTTCATTTTCAGGAGAG‡ R: GATATGGCGTGGGATACACTTC

(CTAT)3CTAG(CTAC)

224 –228

C(A)4C(A)5C(A)8C(A)7(C(A)4)3C(A)5C(A)7C(A)6

Total no. of alleles

HO

HE

FIS

2

0.350

0.358

+0.022

268 – 299

4

0.350

0.349

− 0.004

(AG)22

348 – 378

10

0.450

0.749

+0.405

(A)21

190 –197

2







(GTT)6A(GTT)

188 –200

3

0.300

0.349

+0.143

(A)21

452– 455

2







(CT)9

407– 415

3

0.300

0.328

+0.088

(ATTT)7

165 –177

3

0.700

0.591

− 0.190

(GA)14

117–121

2

0.200

0.185

− 0.086

C(T)4C(T)5C(T)5C(T)3

195 –201

2

0.700

0.508

− 0.393

(CTTT)8

248 –264

4

0.200

0.623

+0.685

(CCAAA)4

118 –153

5

0.650

0.545

− 0.199

(TATG)2(TA)2(TATG)5

206 –234

5

0.050

0.576

+ 0.915

(CAA)2TGG(CAA)2AAA(CAA)5TAA(CAA)3

191–206

5

0.650

0.688

+0.057

(GA)5C(GA)6(A(GA)3)3A(GA)2AA(GA)14

380 – 430

6

0.211

0.589

+0.649

(AC)9

428 – 432

3

0.000

0.185

+1

(AT)6(GTAT)3

141–145

3

0.650

0.617

− 0.056

(CT)20

147–181

7

0.150

0.355

+0.584

(GA)11

158 –182

6

0.450

0.704

+0.367

HO, observed heterozygosity; HE, expected heterozygosity; FIS, fixation index; *, allele sizes and number of alleles for samples from six populations in the species range; †, primer fluorescently labelled with HEX; ‡, primer fluorescently labelled with 6-FAM.

P R I M E R N O T E 707

Primer

708 P R I M E R N O T E and with the aid of the software fastpcr (Kalendar 2005). Synthesized primers (OPERON and Invitrogen) were optimized for amplification on the source tree’s DNA and were visualized on a 2.5% agarose gel. Thirty-seven primers yielded products that were both the expected size and appeared to be polymorphic. Flourescently labelled primers (6-FAM and HEX, OPERON) were obtained for these 37. To screen for polymorphism and test performance in the species’ range, we carried out PCR on extracted DNA from 20 individuals from the Soquel State Demonstration Forest, seven individuals from populations in northern coastal California (Forestville, Cazadero, Salt Point Park and Fish Rock Road) and one individual from an interior population in the Plumas National Forest, Butte County, California. PCR conditions were as follows: 20 mm Tris-HCl (pH 8.4), 50 mm KCl, 25 µg/mL BSA for all except locus Ld3 which had 12.5 µg/mL BSA, 4 mm MgCl2 for all except loci Ld1 and Ld3 which each took 2 mm MgCl2, 0.52 mm of each primer, 150 µm of each dNTP, 1 U Taq DNA polymerase (Invitrogen) and 2.5 µL of a 1:20 dilution of extracted DNA in a 25 µL reaction. PCR profile started with one activation cycle at 95 °C for 10 min followed by two cycles of 1 min denaturing at 94 °C, 1 min annealing at 60 °C and 35 s extension at 70 °C. This was followed by 18 cycles of 45 s denaturing at 93 °C, 45 s annealing at a step-down starting from 59 °C and going down 0.5 °C per cycle, and 45 s extension at 70 °C. Then there were 20 cycles of 30 s denaturing at 92 °C, 30 s annealing at 50 °C and 1 min extension at 70 °C. This was followed by a final extension for 5 min at 72 °C. Two microlitres of PCR product was mixed with a solution of 8 µL of formamide and 0.5 µL of appropriate ROX size standard (ROX 350 or ROX 500, Applied Biosystems) and electrophoresed on an ABI 3100 automated sequencer. Results were analysed with genescan 3.7 and genotyper 3.7 software (Applied Biosystems). Of the 37 tested primers, 19 showed polymorphism within the species range examined here and yielded reproducible and scorable bands (Table 1). The 20 individuals from a single population in Soquel were then screened for fragment size

variation at these loci. Observed and expected heterozygosities in the population were obtained using the program cervus 2.0 (Marshall et al. 1998). Deviation from Hardy– Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were tested with genepop 3.4 (Raymond & Rousset 1995) using the probability test with default values. Of the 19 tested primers, 17 showed polymorphism within the Soquel population (Table 1). Loci Ld4 and Ld6 were fixed. Allelic richness across all individuals scored ranged from two to 10, while allelic richness within the Soquel population ranged from two to eight, excluding the fixed loci. Significant LD was observed between loci Ld1 and Ld2. This could indicate these loci are on the same chromosome. LD can also indicate a history of admixture between two or more populations. This is also supported by significant deviation from HWE (P < 0.002) being detected for loci Ld11, Ld13 and Ld18.

Acknowledgements We would like to thank Alejandro Nettel and Per J. Palsboll for technical advice.

References Cullings KW (1992) Design and testing of a plant-specific PCR primer for ecological and evolutionary studies. Molecular Ecology, 1, 233–240. Glen TC, Schable NA (2005) Isolating microsatellite DNA loci. Methods in Enzymology, 395, 202–222. Kalendar R (2005) FASTPCR (version 3.6.59): software for PCR primer design and analysis. Institute of Biotechnology, University of Helsinki, Finland. Marshall TC, Slate J, Kruuk L, Pemberton JM (1998) Statistical confidence for likelihood-based paternity inference in natural populations. Molecular Ecology, 7, 639–655. McPherson BA, Mori SR, Wood DL et al. (2005) Sudden oak death in California: disease progression in oaks and tanoaks. Forest Ecology and Management, 213, 71–89. Raymond M, Rousset F (1995) genepop (version 1.2): population genetics software for exact tests and ecumenicism. Journal of Heredity, 86, 248–249.

© 2006 The Authors Journal compilation © 2006 Blackwell Publishing Ltd

Characterization of microsatellite markers for the ... - Wiley Online Library

tree, Lithocarpus densiflorus. VERONICA R. F. MORRIS and RICHARD S. DODD. Department of Environmental Science, Policy and Management, University of ...

67KB Sizes 1 Downloads 168 Views

Recommend Documents

Isolation of microsatellite markers for the endangered ...
from South Africa (IUCN Red Data-listed). Its distribution ... SequiTherm EXCEL II DNA Sequencing Kit-LC (Epicentre ... Fragment analysis was performed on an.

Isolation of microsatellite markers for the endangered ...
*Center for Research and Conservation, Royal Zoological Society of Antwerp, ... Technologies) and sequencing products were separated on .... frequency data.

Strategies for online communities - Wiley Online Library
Nov 10, 2008 - This study examines the participation of firms in online communities as a means to enhance demand for their products. We begin with theoretical arguments and then develop a simulation model to illustrate how demand evolves as a functio

Genetic signature of amphimixis allows for the ... - Wiley Online Library
Genetic signature of amphimixis allows for the detection and fine scale localization of sexual reproduction events in a mainly parthenogenetic nematode.

Principles of periodontology - Wiley Online Library
genetic make-up, and modulated by the presence or ab- sence of ... can sense and destroy intruders. ..... observation that apparently healthy Japanese sub-.

XIIntention and the Self - Wiley Online Library
May 9, 2011 - The former result is a potential basis for a Butlerian circularity objection to. Lockean theories of personal identity. The latter result undercuts a prom- inent Lockean reply to 'the thinking animal' objection which has recently suppla